ID: 1078414863

View in Genome Browser
Species Human (GRCh38)
Location 11:11156741-11156763
Sequence CGTGGACCCAGCCCAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078414863_1078414872 -4 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414872 11:11156760-11156782 CACGGCTCTGCCCCTGAGAGGGG No data
1078414863_1078414874 4 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414874 11:11156768-11156790 TGCCCCTGAGAGGGGGAATCAGG No data
1078414863_1078414871 -5 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414871 11:11156759-11156781 CCACGGCTCTGCCCCTGAGAGGG No data
1078414863_1078414878 23 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414863_1078414873 -3 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414863_1078414879 24 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414879 11:11156788-11156810 AGGCAAGTCCAACCCCTCCAGGG No data
1078414863_1078414869 -6 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414869 11:11156758-11156780 TCCACGGCTCTGCCCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078414863 Original CRISPR CGTGGACCCAGCCCAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr