ID: 1078414873

View in Genome Browser
Species Human (GRCh38)
Location 11:11156761-11156783
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078414853_1078414873 23 Left 1078414853 11:11156715-11156737 CCTCGTGTGCACCACATTCCCTA No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414861_1078414873 -1 Left 1078414861 11:11156739-11156761 CCCCCTCCCCTGGGCTGGGTCCA No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414852_1078414873 28 Left 1078414852 11:11156710-11156732 CCAGGCCTCGTGTGCACCACATT No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414863_1078414873 -3 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414867_1078414873 -8 Left 1078414867 11:11156746-11156768 CCCTGGGCTGGGTCCACGGCTCT No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414868_1078414873 -9 Left 1078414868 11:11156747-11156769 CCTGGGCTGGGTCCACGGCTCTG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414857_1078414873 5 Left 1078414857 11:11156733-11156755 CCCTAACCCCCTCCCCTGGGCTG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414866_1078414873 -7 Left 1078414866 11:11156745-11156767 CCCCTGGGCTGGGTCCACGGCTC No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414862_1078414873 -2 Left 1078414862 11:11156740-11156762 CCCCTCCCCTGGGCTGGGTCCAC No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414854_1078414873 12 Left 1078414854 11:11156726-11156748 CCACATTCCCTAACCCCCTCCCC No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414858_1078414873 4 Left 1078414858 11:11156734-11156756 CCTAACCCCCTCCCCTGGGCTGG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data
1078414864_1078414873 -4 Left 1078414864 11:11156742-11156764 CCTCCCCTGGGCTGGGTCCACGG No data
Right 1078414873 11:11156761-11156783 ACGGCTCTGCCCCTGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078414873 Original CRISPR ACGGCTCTGCCCCTGAGAGG GGG Intergenic
No off target data available for this crispr