ID: 1078414878

View in Genome Browser
Species Human (GRCh38)
Location 11:11156787-11156809
Sequence CAGGCAAGTCCAACCCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078414858_1078414878 30 Left 1078414858 11:11156734-11156756 CCTAACCCCCTCCCCTGGGCTGG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414863_1078414878 23 Left 1078414863 11:11156741-11156763 CCCTCCCCTGGGCTGGGTCCACG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414876_1078414878 -7 Left 1078414876 11:11156771-11156793 CCCTGAGAGGGGGAATCAGGCAA No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414867_1078414878 18 Left 1078414867 11:11156746-11156768 CCCTGGGCTGGGTCCACGGCTCT No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414875_1078414878 -6 Left 1078414875 11:11156770-11156792 CCCCTGAGAGGGGGAATCAGGCA No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414877_1078414878 -8 Left 1078414877 11:11156772-11156794 CCTGAGAGGGGGAATCAGGCAAG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414861_1078414878 25 Left 1078414861 11:11156739-11156761 CCCCCTCCCCTGGGCTGGGTCCA No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414870_1078414878 5 Left 1078414870 11:11156759-11156781 CCACGGCTCTGCCCCTGAGAGGG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414862_1078414878 24 Left 1078414862 11:11156740-11156762 CCCCTCCCCTGGGCTGGGTCCAC No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414868_1078414878 17 Left 1078414868 11:11156747-11156769 CCTGGGCTGGGTCCACGGCTCTG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414864_1078414878 22 Left 1078414864 11:11156742-11156764 CCTCCCCTGGGCTGGGTCCACGG No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data
1078414866_1078414878 19 Left 1078414866 11:11156745-11156767 CCCCTGGGCTGGGTCCACGGCTC No data
Right 1078414878 11:11156787-11156809 CAGGCAAGTCCAACCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078414878 Original CRISPR CAGGCAAGTCCAACCCCTCC AGG Intergenic
No off target data available for this crispr