ID: 1078416772

View in Genome Browser
Species Human (GRCh38)
Location 11:11172458-11172480
Sequence CAGTGGAGAAGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078416762_1078416772 17 Left 1078416762 11:11172418-11172440 CCAGAGAAGGGGCAATGGCAGTT No data
Right 1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG No data
1078416761_1078416772 18 Left 1078416761 11:11172417-11172439 CCCAGAGAAGGGGCAATGGCAGT No data
Right 1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG No data
1078416756_1078416772 30 Left 1078416756 11:11172405-11172427 CCACTACAGGGGCCCAGAGAAGG No data
Right 1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078416772 Original CRISPR CAGTGGAGAAGGAGAGAAGT GGG Intergenic
No off target data available for this crispr