ID: 1078417052

View in Genome Browser
Species Human (GRCh38)
Location 11:11174455-11174477
Sequence CACCAGTGTCTAATATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078417043_1078417052 6 Left 1078417043 11:11174426-11174448 CCTGCCCGGCCACTCCTGATTTA No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data
1078417046_1078417052 1 Left 1078417046 11:11174431-11174453 CCGGCCACTCCTGATTTAAGGCT No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data
1078417045_1078417052 2 Left 1078417045 11:11174430-11174452 CCCGGCCACTCCTGATTTAAGGC No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data
1078417048_1078417052 -8 Left 1078417048 11:11174440-11174462 CCTGATTTAAGGCTGCACCAGTG No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data
1078417047_1078417052 -3 Left 1078417047 11:11174435-11174457 CCACTCCTGATTTAAGGCTGCAC No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data
1078417042_1078417052 7 Left 1078417042 11:11174425-11174447 CCCTGCCCGGCCACTCCTGATTT No data
Right 1078417052 11:11174455-11174477 CACCAGTGTCTAATATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078417052 Original CRISPR CACCAGTGTCTAATATGGAG GGG Intergenic
No off target data available for this crispr