ID: 1078417864

View in Genome Browser
Species Human (GRCh38)
Location 11:11180489-11180511
Sequence ATGGTTGTCCGCGGGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078417864_1078417872 -9 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417872 11:11180503-11180525 GACAACCATCCTGGAAAGGTGGG No data
1078417864_1078417877 1 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417877 11:11180513-11180535 CTGGAAAGGTGGGAGGAGGTAGG No data
1078417864_1078417873 -6 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417873 11:11180506-11180528 AACCATCCTGGAAAGGTGGGAGG No data
1078417864_1078417878 19 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417878 11:11180531-11180553 GTAGGACCACAAGCAAGCTGAGG No data
1078417864_1078417871 -10 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417871 11:11180502-11180524 GGACAACCATCCTGGAAAGGTGG No data
1078417864_1078417875 -3 Left 1078417864 11:11180489-11180511 CCACAGCCCCCGCGGACAACCAT No data
Right 1078417875 11:11180509-11180531 CATCCTGGAAAGGTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078417864 Original CRISPR ATGGTTGTCCGCGGGGGCTG TGG (reversed) Intergenic
No off target data available for this crispr