ID: 1078421923

View in Genome Browser
Species Human (GRCh38)
Location 11:11219538-11219560
Sequence AAACTGGGGGGACGCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078421923_1078421930 11 Left 1078421923 11:11219538-11219560 CCCAGTGAGCGTCCCCCCAGTTT No data
Right 1078421930 11:11219572-11219594 AGCTTGCTCATTTGCTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078421923 Original CRISPR AAACTGGGGGGACGCTCACT GGG (reversed) Intergenic
No off target data available for this crispr