ID: 1078422010

View in Genome Browser
Species Human (GRCh38)
Location 11:11220225-11220247
Sequence GAAGATTCACATGGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078422010_1078422013 28 Left 1078422010 11:11220225-11220247 CCACTTTCTCCATGTGAATCTTC No data
Right 1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG No data
1078422010_1078422012 24 Left 1078422010 11:11220225-11220247 CCACTTTCTCCATGTGAATCTTC No data
Right 1078422012 11:11220272-11220294 TAGAGACTATGAGAGTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078422010 Original CRISPR GAAGATTCACATGGAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr