ID: 1078422011

View in Genome Browser
Species Human (GRCh38)
Location 11:11220234-11220256
Sequence TGTCTTAAAGAAGATTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078422011_1078422014 22 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422014 11:11220279-11220301 TATGAGAGTATAGAGGATGGTGG No data
1078422011_1078422015 23 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422015 11:11220280-11220302 ATGAGAGTATAGAGGATGGTGGG No data
1078422011_1078422012 15 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422012 11:11220272-11220294 TAGAGACTATGAGAGTATAGAGG No data
1078422011_1078422016 24 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422016 11:11220281-11220303 TGAGAGTATAGAGGATGGTGGGG No data
1078422011_1078422013 19 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078422011 Original CRISPR TGTCTTAAAGAAGATTCACA TGG (reversed) Intergenic
No off target data available for this crispr