ID: 1078422013

View in Genome Browser
Species Human (GRCh38)
Location 11:11220276-11220298
Sequence GACTATGAGAGTATAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078422011_1078422013 19 Left 1078422011 11:11220234-11220256 CCATGTGAATCTTCTTTAAGACA No data
Right 1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG No data
1078422010_1078422013 28 Left 1078422010 11:11220225-11220247 CCACTTTCTCCATGTGAATCTTC No data
Right 1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078422013 Original CRISPR GACTATGAGAGTATAGAGGA TGG Intergenic
No off target data available for this crispr