ID: 1078422758

View in Genome Browser
Species Human (GRCh38)
Location 11:11225699-11225721
Sequence CCTACATGGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078422750_1078422758 16 Left 1078422750 11:11225660-11225682 CCAAGTTGCTGCATTCTCTAGAG No data
Right 1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078422758 Original CRISPR CCTACATGGCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr