ID: 1078432403

View in Genome Browser
Species Human (GRCh38)
Location 11:11298133-11298155
Sequence CAGGGTATCCTGCAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078432403_1078432409 -9 Left 1078432403 11:11298133-11298155 CCCCCATCCTGCAGGATACCCTG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1078432409 11:11298147-11298169 GATACCCTGGTCTCAGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078432403 Original CRISPR CAGGGTATCCTGCAGGATGG GGG (reversed) Intronic
901129923 1:6955830-6955852 CTGGGCATGGTGCAGGATGGAGG - Intronic
902880484 1:19368905-19368927 CAGGGTCTCTGGCAGGATGGGGG + Intronic
906827817 1:49000446-49000468 CAAGGTATGCTGGAGGCTGGAGG - Intronic
910101481 1:83582845-83582867 CAGGGCAGCCTGAAGCATGGGGG - Intergenic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
914348848 1:146822445-146822467 CAGGGTCTCCTGGAGCATGGCGG + Intergenic
916865473 1:168851966-168851988 TAGGGTAACCTGGAGGTTGGAGG - Intergenic
918096124 1:181335597-181335619 CAGGGCATGCTCCAGGATGCAGG - Intergenic
918213663 1:182374307-182374329 TAGGGATTCCTGCAGGATGCTGG + Intergenic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
918526934 1:185474918-185474940 CAGATTATGCTGCAGGAGGGAGG - Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921716421 1:218421746-218421768 GAGGTCATCCTGCAGGAGGGTGG + Intronic
922781874 1:228259295-228259317 CAGGGCACCCTGCAGAATGGTGG - Intronic
924562283 1:245166805-245166827 CAGGATATCCTGCTTGGTGGGGG - Intronic
1063439955 10:6064737-6064759 CAGGGCCTGCTGCAGGGTGGGGG - Intergenic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1067077091 10:43194107-43194129 CAGGGCAGCCTGCAGAATGCAGG - Intergenic
1067738665 10:48878824-48878846 CAGGGTTTCCTCCTGTATGGAGG - Intronic
1068370250 10:56103817-56103839 CGGGGTCTCCTGGAGGGTGGTGG - Intergenic
1070375127 10:75822872-75822894 TAGGGTATCAGCCAGGATGGTGG - Intronic
1070402776 10:76067977-76067999 CAGGGAAACCTGCAAGAAGGGGG + Intronic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070571662 10:77644308-77644330 CTGGAAATCCTGCAGAATGGTGG - Intergenic
1070818386 10:79339662-79339684 GAGGGTCTCTTGCAGGTTGGGGG + Intergenic
1073992577 10:109279654-109279676 CAAGGTGTCATCCAGGATGGTGG + Intergenic
1074045389 10:109833226-109833248 CAGGATATGCTTCAGGAAGGAGG + Intergenic
1074591982 10:114822095-114822117 CACGGCGTGCTGCAGGATGGAGG - Exonic
1074764152 10:116688131-116688153 TAGCCTCTCCTGCAGGATGGTGG + Intronic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1079179428 11:18176004-18176026 AAGGGTTTCCTACAGGTTGGAGG + Intronic
1081547565 11:44082642-44082664 CAGGGTGTTCTTTAGGATGGTGG + Intronic
1084758947 11:71256205-71256227 CAGGGCATCCTGTAGGATGGAGG + Intergenic
1087604457 11:100360129-100360151 CTGGGTATACTGCATGATGCTGG + Intergenic
1087910743 11:103750749-103750771 CAGGGAATGCTGCATGAAGGAGG + Intergenic
1089489130 11:118870736-118870758 CAGGGGACCCTGGAGGATCGTGG + Intergenic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1096235947 12:49926550-49926572 AAGGCTATACTGCAGGATGCTGG + Intergenic
1096530694 12:52241101-52241123 CAGAGTATTCTGTAGCATGGTGG + Intronic
1097763585 12:63497348-63497370 CAGGGCCTACTACAGGATGGAGG + Intergenic
1100722955 12:97378151-97378173 CAGATTATCCTGCATAATGGGGG - Intergenic
1104642862 12:130478526-130478548 CAGGGCATCGTCCAGGATGGGGG + Intronic
1106760023 13:32859023-32859045 CAGCAGATCCTGCAGGAAGGGGG + Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110348279 13:74475091-74475113 TTTGGTATCCTGCAGGGTGGGGG + Intergenic
1113877843 13:113605857-113605879 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877868 13:113605963-113605985 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877879 13:113606004-113606026 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877889 13:113606045-113606067 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877909 13:113606127-113606149 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877919 13:113606168-113606190 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1117512120 14:56463038-56463060 CAGTGTTTCCTGCATGATGCCGG + Intergenic
1118496414 14:66312116-66312138 CAGGGAATCCTCCAGTTTGGAGG - Intergenic
1119193834 14:72702522-72702544 AATGGTATCCGGCAGGATGTGGG - Intronic
1121300443 14:92866476-92866498 CAAGCTAGCCTGCTGGATGGTGG - Intergenic
1123921860 15:25075831-25075853 CATGGTCTCCTTCAGGCTGGTGG + Intergenic
1128264195 15:66253364-66253386 CAGGGGGTCCGGCAGGATGTAGG - Intronic
1129843445 15:78757469-78757491 CAGGGTAGCCTGGAGCTTGGAGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1137754922 16:50893647-50893669 TAGGGTATCCTGCAAGAAAGGGG - Intergenic
1139630864 16:68231177-68231199 CAGGGCAGCTTGCAGGGTGGAGG + Exonic
1139985188 16:70893110-70893132 CAGGGTCTCCTGGAGCATGGCGG - Intronic
1141154635 16:81588708-81588730 CAGGGTCTCCTGCATGCTGGGGG - Intronic
1141411631 16:83838163-83838185 CATTGTATCCTCTAGGATGGAGG + Intergenic
1141501898 16:84450360-84450382 CAGGGGATCTAGCAGGTTGGGGG - Intronic
1141881721 16:86864587-86864609 CAGGGCCTCCTGGAGGGTGGAGG - Intergenic
1142621187 17:1166591-1166613 GAGTTTATCCTGCAGGAAGGAGG + Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1144367198 17:14555964-14555986 CAGAGTAACCTCCAGGATCGGGG - Intergenic
1145768420 17:27475339-27475361 CTGTGGATCCTACAGGATGGAGG - Intronic
1146393215 17:32442025-32442047 CTGGGTTTCCTCCAGGGTGGAGG + Intergenic
1146585432 17:34077937-34077959 CAGGATGTCCTGGAGGAAGGAGG - Intronic
1147141620 17:38463602-38463624 CAGGGTATCTGGAAGGAGGGTGG + Intronic
1148455737 17:47810534-47810556 CAGGCAATCCTTCAGGCTGGAGG - Intronic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1148907606 17:50921152-50921174 CAGGGCAGCCTGCAGGACAGAGG - Intergenic
1149556983 17:57580410-57580432 CGGGGTTTCCTGTAGGCTGGGGG - Intronic
1156256121 18:35398241-35398263 CAGAGCATCCTGGAGGCTGGAGG + Intergenic
1156517037 18:37688832-37688854 CAGGATATCCTGCAGGTTAGAGG - Intergenic
1158266720 18:55667045-55667067 CAGGGCATGCTGCAGGCTGCAGG + Intergenic
1158343157 18:56488030-56488052 CAGGGTATCTGGAAGGATGTGGG - Intergenic
1158891000 18:61871619-61871641 CAGGCTATTCTGCAGGTTGTGGG + Intronic
1160607142 18:80059672-80059694 AAGGGTGTCCTGCAGGAAGAGGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1162554704 19:11379602-11379624 CAGGGCCTTCTGCAGGGTGGTGG - Intronic
1163217203 19:15889685-15889707 CTGGGTTTCCTGCAGGATAAGGG + Exonic
1163345799 19:16741292-16741314 CAGAGTATCTTGCAGGCAGGGGG - Intronic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1166217213 19:41343577-41343599 CAGGGAGGCATGCAGGATGGGGG - Intronic
1166610256 19:44185692-44185714 AAAGGTAGCCTGCAGAATGGAGG - Intergenic
1167169014 19:47818641-47818663 CAGGCTCTACTGCAGGATGGGGG - Intronic
925728038 2:6893411-6893433 CAGGGAAGCCTTCAGGATGAAGG + Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927495019 2:23546304-23546326 CAGGGGACCCTGCAGAATGAGGG + Intronic
932132485 2:69200428-69200450 CAGGTTATCCTCCAGGAGAGAGG + Intronic
933989129 2:87621115-87621137 GAGGTTATCCTGCAAAATGGAGG + Intergenic
935641697 2:105297035-105297057 CAGGTTAACTTGCAGGATTGTGG - Intronic
936267804 2:111023629-111023651 CTGGGTATGGAGCAGGATGGAGG + Intronic
936304714 2:111329711-111329733 GAGGTTATCCTGCAAAATGGAGG - Intergenic
939021891 2:136967100-136967122 CATGGTATCCTGCAGGTGGGAGG + Intronic
941562029 2:167058618-167058640 CAGGCTATTCTGCTGGAGGGAGG - Intronic
945703243 2:213198066-213198088 CAGAGTCTCCTTCAAGATGGAGG + Intergenic
946379772 2:219338825-219338847 CAGGGTATGATGCAGGATGTGGG - Intergenic
948051929 2:234985065-234985087 CGGGTCAGCCTGCAGGATGGAGG - Intronic
1170836503 20:19889141-19889163 CAGGAAATCCTGCTGGAAGGGGG - Intronic
1171500879 20:25592162-25592184 CAGGGTATCGCCCAGGCTGGAGG - Intergenic
1172948040 20:38703634-38703656 CAGGGCATGCAGCAGGGTGGTGG - Intergenic
1175623665 20:60472728-60472750 CTGGGCATCCTGCAGTGTGGGGG - Intergenic
1175753656 20:61515924-61515946 CAGGATAGACTGCGGGATGGGGG - Intronic
1178902054 21:36606037-36606059 CAGGGCATCCTGCAGGGTGGAGG - Intergenic
1179896433 21:44366115-44366137 GAGGGTCTCCTGGAGGACGGGGG + Intronic
1180972550 22:19822960-19822982 CAAGGTGTCCTGCAGAGTGGAGG + Intronic
1183247942 22:36708332-36708354 CAGGGGATGATGCAGGAAGGTGG + Intergenic
1183692680 22:39399787-39399809 CAGGGGTTCCTCCAAGATGGCGG + Exonic
1184383641 22:44161903-44161925 CAGGCTGTCCTGCAGGGTTGGGG + Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184489292 22:44799876-44799898 CAGGGTGTCCTGCATGCAGGGGG + Intronic
1184781638 22:46652566-46652588 CAAGGTGTCCTGCAGGGTGGGGG - Intronic
1185398174 22:50603209-50603231 GAGGCTGTCCTGCAGGACGGAGG - Exonic
950043584 3:9935163-9935185 CACGGTAGACTGCAGGACGGTGG + Intronic
950127049 3:10516229-10516251 CAGGGCAGCCTGCAGCAGGGAGG - Intronic
950407969 3:12816410-12816432 CAGGGCATCCATCCGGATGGTGG - Exonic
950514509 3:13455475-13455497 CAGGCTAGCCTGCTGGAGGGAGG - Intergenic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954156513 3:48687819-48687841 CTGGGTAACCTTCAGGATGCTGG + Intergenic
954640337 3:52094004-52094026 AAGGATGTTCTGCAGGATGGAGG + Intronic
956744506 3:72300839-72300861 CAGGGAATCATGAAAGATGGGGG - Intergenic
957199062 3:77108649-77108671 CAGGGCATACTGCAGGAGTGAGG + Intronic
959940385 3:112075125-112075147 CAGGGCATGCTTCAGGAAGGAGG + Intronic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
965043869 3:163550005-163550027 CAGGGTCTCCTGGAGGGTTGAGG - Intergenic
965559062 3:170044621-170044643 CAGGGTGTCCTGCAGGGATGGGG + Intronic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
966860240 3:184227657-184227679 TAGGGCACCCTGCAGGATGAGGG - Intronic
968541592 4:1171005-1171027 CACCGTGTCCTGCGGGATGGTGG + Exonic
969556194 4:7912082-7912104 AAGGGTATTATGCATGATGGTGG + Intronic
969583131 4:8076988-8077010 GAGGGTGGGCTGCAGGATGGGGG + Intronic
969583145 4:8077030-8077052 AAGGGTGGGCTGCAGGATGGGGG + Intronic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972528816 4:39942928-39942950 AAGGATCTCCTGAAGGATGGGGG + Intronic
975918290 4:79351039-79351061 CTGGGTATCCTGCATGATGCTGG - Intergenic
976205476 4:82619602-82619624 CAGGGTGTTCAGCAGGGTGGAGG + Intergenic
980990990 4:139738173-139738195 CAGGGCATCCTTCAGGGTGAGGG + Intronic
981308942 4:143276917-143276939 AAGGGTATCCTGCAGGAGCTGGG - Intergenic
982766379 4:159353723-159353745 CAGGGGATCCTGCAGGTTTATGG + Exonic
983103040 4:163649714-163649736 CAGGGTATCATGGAAGGTGGTGG - Intronic
985218248 4:187675543-187675565 CAGTATCTCCTGCTGGATGGAGG + Intergenic
985680480 5:1253328-1253350 CAGGGTCTCCACCTGGATGGTGG + Exonic
986217439 5:5732667-5732689 CAGGGTACACTGGAGGGTGGAGG - Intergenic
986388331 5:7261302-7261324 CAGGGATTCCTGCAGGAGTGGGG + Intergenic
988885443 5:35552541-35552563 GACTGTATCCTGCAGGAGGGGGG - Intergenic
990119443 5:52431937-52431959 AAGGGGATCCTGGAGGATGAGGG - Intergenic
995241621 5:109891101-109891123 CAGGGTCTCCTGAAGCTTGGAGG - Intergenic
996013356 5:118504843-118504865 TAGGGTTTCCTGGAGGAAGGAGG - Intergenic
996481200 5:123976631-123976653 CAGGTTAGCCTGCAGGAAGAAGG - Intergenic
996968513 5:129334094-129334116 CAGGGTGTACTTCAGGATGGAGG + Intergenic
998184908 5:139971027-139971049 CAGGATAGTCTCCAGGATGGTGG - Intronic
998343762 5:141442119-141442141 CAGAGTCTCCTGCAGGCTGTCGG - Intronic
998902724 5:146873280-146873302 CATGGTGTGCTCCAGGATGGTGG - Intronic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999261142 5:150239623-150239645 CAGTGCAGCCTGCAGGAGGGAGG + Intronic
1002647599 5:180668506-180668528 CAGGTTAGCCTGCTGGAGGGTGG + Intergenic
1002696778 5:181097660-181097682 CAGCGAATCCTGCTGGAAGGCGG - Intergenic
1002697844 5:181101713-181101735 CAGCGAATCCTGCTGGAAGGCGG + Intergenic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1002764615 6:228204-228226 CAGGCTGCCCCGCAGGATGGTGG + Intergenic
1004732199 6:18368637-18368659 CGGGGTCTCCCGCAGCATGGCGG - Intergenic
1006259687 6:32857436-32857458 CAGGGATTCATGCAGGTTGGGGG - Intronic
1007787267 6:44287811-44287833 TACGGTATCCTGCATGCTGGAGG + Exonic
1009375778 6:62966527-62966549 CAGGGCATACTGCATGATGCTGG + Intergenic
1011175734 6:84558634-84558656 CAGTGTATCTTACAGGATGTTGG - Intergenic
1011830736 6:91368361-91368383 CAGGGCCTGTTGCAGGATGGGGG - Intergenic
1014334763 6:120119746-120119768 CTGGGTATACTGCATGATGGAGG + Intergenic
1014504855 6:122242703-122242725 CAGGATATGCTGTGGGATGGAGG - Intergenic
1019268113 7:130339-130361 CAGGGTCTCCTCCAGGCTGTTGG - Intergenic
1019298341 7:290577-290599 CACGGCGTCCTGCGGGATGGGGG + Intergenic
1019322136 7:420592-420614 CACGGTATCCTGCAGGAGCTTGG - Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1020279288 7:6642300-6642322 CAGGGTCTCCCGCAGCCTGGCGG - Intronic
1022472279 7:30689154-30689176 CAGGGGCTGCTGCAGGGTGGTGG + Intronic
1022662802 7:32382222-32382244 CAGGGAGTCAGGCAGGATGGCGG - Intergenic
1023674123 7:42612630-42612652 CAGGGTCTCATCCAGGAGGGGGG + Intergenic
1023989413 7:45119238-45119260 CAGGAGGTCCTGCAGGCTGGAGG - Intergenic
1023999780 7:45182756-45182778 TAGGGTATCCTGGATGATGAAGG + Intronic
1025027260 7:55526811-55526833 CAGGGTTTGCTTCAGGATGGTGG + Intronic
1026380214 7:69792006-69792028 TAGGCATTCCTGCAGGATGGTGG + Intronic
1027989768 7:85343191-85343213 CAGGAAATCCAGCAGGATTGTGG + Intergenic
1028556683 7:92133711-92133733 CAGGGCAGCCTCCAGGATGACGG + Intronic
1030249322 7:107424771-107424793 AAGGGTATCATGCAGGATTTTGG - Intronic
1030812281 7:113989338-113989360 CAGGATATGCTGTGGGATGGGGG - Intronic
1031465459 7:122104763-122104785 CAGGGTATACTTGAGGGTGGAGG + Intronic
1033537280 7:142323841-142323863 CAGGGTTCCCTGCAGCATAGTGG - Intergenic
1033539000 7:142338819-142338841 CAGGGTTCCCTGCAGCATTGTGG - Intergenic
1033563606 7:142557855-142557877 CAGGGTGGCCTGCAGTTTGGAGG + Intergenic
1034359192 7:150479150-150479172 CAGGGTATACTTGAGGGTGGAGG + Exonic
1035584404 8:760879-760901 TAGGGTCTCCCGCAGCATGGTGG - Intergenic
1036505538 8:9351842-9351864 CAGGGTATTCTTCAGAATGAAGG - Intergenic
1038523395 8:28252715-28252737 CAGGCTCTCCTGCTGGAGGGCGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1046882709 8:119327748-119327770 CAGGTTATCCTACAGGAGGCAGG + Intergenic
1048550879 8:135432823-135432845 CAGGGTATCCTGGATGAGGCAGG + Intergenic
1049325497 8:142019470-142019492 CAGGGAATACTGCATGATGCTGG - Intergenic
1057832711 9:98419243-98419265 AAGGGTATCCTGCTGGGAGGTGG + Intronic
1059235591 9:112758217-112758239 CAGGGTCTCCAAGAGGATGGGGG - Intronic
1059343789 9:113615008-113615030 AGGGGGATCCTTCAGGATGGCGG - Intergenic
1059925802 9:119208105-119208127 CCGGGTATTCTGCTAGATGGTGG - Intronic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1061226483 9:129283715-129283737 CAGGAGATCCTGGAGGGTGGCGG - Intergenic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1189097954 X:38159980-38160002 CAGGTTCTGCTGCAGGCTGGAGG + Intronic
1192924572 X:75741871-75741893 CAGGATATGCTGCAGGATCATGG + Intergenic
1194290021 X:92060487-92060509 CAGGGTCTACTTCAGGGTGGAGG - Intronic
1197094233 X:122574472-122574494 CAGGGCATCCTGGAGGAAGTGGG + Intergenic
1198985009 X:142441160-142441182 CAGGGTTTCCTACAGGGTAGTGG - Intergenic
1199606133 X:149581122-149581144 AAGGGTTTCCTGCAAGATGAGGG - Intergenic
1199632988 X:149788246-149788268 AAGGGTTTCCTGCAAGATGAGGG + Intergenic