ID: 1078432957

View in Genome Browser
Species Human (GRCh38)
Location 11:11301779-11301801
Sequence CTGGGCATTGGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 377}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078432940_1078432957 28 Left 1078432940 11:11301728-11301750 CCCATTCAATTCAACAAACACCC 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG 0: 1
1: 0
2: 4
3: 41
4: 377
1078432941_1078432957 27 Left 1078432941 11:11301729-11301751 CCATTCAATTCAACAAACACCCT 0: 1
1: 0
2: 1
3: 19
4: 282
Right 1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG 0: 1
1: 0
2: 4
3: 41
4: 377
1078432944_1078432957 8 Left 1078432944 11:11301748-11301770 CCCTCTTTGCCTCTCGGGTGCCA 0: 1
1: 0
2: 0
3: 13
4: 226
Right 1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG 0: 1
1: 0
2: 4
3: 41
4: 377
1078432949_1078432957 -1 Left 1078432949 11:11301757-11301779 CCTCTCGGGTGCCAGGGCTGGCC 0: 1
1: 0
2: 1
3: 14
4: 352
Right 1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG 0: 1
1: 0
2: 4
3: 41
4: 377
1078432945_1078432957 7 Left 1078432945 11:11301749-11301771 CCTCTTTGCCTCTCGGGTGCCAG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG 0: 1
1: 0
2: 4
3: 41
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078432957 Original CRISPR CTGGGCATTGGGAAAGCAGA GGG Intronic
900880497 1:5377930-5377952 CTGGGAACTGGGAAAGCAAATGG + Intergenic
901217822 1:7564697-7564719 CTGGACACTGGGAGGGCAGAGGG - Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901776084 1:11561213-11561235 ATGGGCATGGGGAGAGCTGAAGG + Intergenic
902842301 1:19082685-19082707 CTGGACTCTGGGAAAGCAGGAGG + Intronic
904455757 1:30647094-30647116 CTGGGCAGTGGCTCAGCAGAAGG - Intergenic
905224890 1:36472504-36472526 CTGGGCACTGGTGAGGCAGAGGG - Exonic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906229151 1:44146144-44146166 CTGGCCCTTGGAAAAACAGAAGG + Intergenic
906789586 1:48647009-48647031 CTGGGCCTTGGGGAAGCAGAAGG - Intronic
907093971 1:51758269-51758291 CTGGGCAGTGGCAAAGCAGTGGG + Intronic
907632248 1:56094435-56094457 ATGGGCAATGGCTAAGCAGATGG + Intergenic
908422802 1:63975875-63975897 CTGGGGATTGCTAAAACAGACGG + Intronic
908998182 1:70184404-70184426 CTGGACATTTGGAAGGCAGAAGG + Intronic
909187027 1:72500730-72500752 CTGGGCAATGGAAAAGCAAGAGG + Intergenic
910719798 1:90273546-90273568 CTGGGCATTTTTAAAGCAGCAGG + Intergenic
910879882 1:91913734-91913756 ATGGGCATTGGGACGGGAGAGGG + Intergenic
911134309 1:94422802-94422824 CTGGGTAGTGGGAAATCAGTGGG + Intronic
911364849 1:96925751-96925773 TTTGGCTTTGGGAAAACAGAAGG + Intergenic
912849672 1:113112017-113112039 CTGGAACTAGGGAAAGCAGAAGG - Intronic
915039370 1:152955098-152955120 CTGGGCATTGGGGAAGGACTGGG + Intergenic
915195688 1:154187956-154187978 CTGGGCTTTGGGCAAGTGGATGG - Intronic
915310310 1:155003077-155003099 CGGGGTGTTGGGAAAGCACAGGG - Intronic
916652438 1:166844404-166844426 CTGGGAATTGGGAAAGGAGTAGG + Intronic
917237667 1:172912238-172912260 CTGGGCATTGAGAAAGCTGAAGG - Intergenic
918066712 1:181106239-181106261 CTGGGCTGTGGGACAGCAGAAGG + Intergenic
919878033 1:201884827-201884849 CTGGGCCTCAGGAAAGAAGAGGG - Intergenic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920390854 1:205599836-205599858 CTGGGCACTTTGAAAGCAGTGGG - Intronic
922207684 1:223462418-223462440 CTGGGTATTGGGAAAGAAAAGGG + Intergenic
923142331 1:231171221-231171243 CTGGGTACTGGGAAACCATATGG + Intronic
923721132 1:236467994-236468016 CTGGGCACTGGGACAGCACAGGG + Intronic
1063162625 10:3430685-3430707 CTGTGCATTGGGCAGGCTGATGG - Intergenic
1063649390 10:7918197-7918219 CTGGGAGTGGGGAAAGGAGAAGG + Intronic
1068548678 10:58382222-58382244 TTGCACATTGGTAAAGCAGAAGG - Intergenic
1070603460 10:77881853-77881875 CTGGGCATTAGGCAAGGACATGG + Intronic
1070746265 10:78935820-78935842 CAGGGCTCTGGGAAACCAGACGG + Intergenic
1071418539 10:85464324-85464346 CTCTGCATTTGGAAAGGAGAAGG + Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072234146 10:93438682-93438704 CTAGGGATAGGGAAGGCAGAAGG + Intronic
1072462990 10:95637437-95637459 CTGGGCATTGAGAAAGGAAAGGG + Intronic
1074418383 10:113287038-113287060 CTGAGCAAAGGGCAAGCAGAGGG - Intergenic
1074522008 10:114234485-114234507 CTGGGAATTTGGAGAGGAGATGG + Intergenic
1074697242 10:116060558-116060580 CTGGGCACAGTGACAGCAGAAGG - Intronic
1074838905 10:117328715-117328737 CTGGGCATTGGCAAAACAGTGGG - Intronic
1074915055 10:117947485-117947507 CTGGGAGTTGGAAAAGCAAAGGG - Intergenic
1075091604 10:119446927-119446949 CAGGGCATTGGGAAAAGACAAGG + Intronic
1075448995 10:122534564-122534586 CTGGCCATGGGGAAAGCCTAGGG + Intergenic
1076811808 10:132890271-132890293 CAGGGCACTGGGGAGGCAGAAGG - Intronic
1076993354 11:287199-287221 CTGGGCATTTGAAAACCCGAAGG + Intergenic
1077056840 11:597967-597989 CTGGGCATTGGACAAGCAGGAGG + Intronic
1078156055 11:8801073-8801095 ATGGGAATTGGGAAGGCTGATGG - Intronic
1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG + Intronic
1080840338 11:35977962-35977984 GTGGGCTTAGGGAAAACAGATGG + Intronic
1081256730 11:40905636-40905658 CTGGACTTGGGGAAATCAGAAGG - Intronic
1081595692 11:44457955-44457977 GTGGCCATTAGGAAAGGAGAGGG - Intergenic
1081610938 11:44563086-44563108 CTGGCCATTGGCAAAACAGCTGG - Intergenic
1081769560 11:45640459-45640481 CTGGGAATGGGGAAAGGAAACGG + Intergenic
1083004713 11:59332476-59332498 GGGAGCATTGGGAAAGGAGAAGG + Intergenic
1083270420 11:61569493-61569515 CTGGGCTCTGGGGCAGCAGAGGG + Intronic
1083597030 11:63922870-63922892 CTGGGCATGGGGCATGCAGATGG - Intergenic
1083629052 11:64086451-64086473 GAGGGCATGGGGAGAGCAGAGGG - Intronic
1083660219 11:64248636-64248658 CTGGGCATTGTGAAGGCAATGGG + Intergenic
1083779193 11:64909413-64909435 CTGGGCATTGGGGAAGAAATAGG - Intronic
1084223635 11:67700527-67700549 AGGGGCATTGGGGGAGCAGAAGG - Intergenic
1084644838 11:70450303-70450325 CTGGTATTTGGGAAAGCAAATGG + Intergenic
1084893198 11:72247066-72247088 CTCAGAATTGGGAAATCAGATGG + Intergenic
1087018036 11:93573587-93573609 CATGGCATTGGAAAAGAAGATGG + Intergenic
1087111790 11:94477863-94477885 CTGGGCTTTTGGAAAGAAGCGGG - Intronic
1087593199 11:100218911-100218933 CTTAGCATTGGCATAGCAGATGG + Intronic
1087804591 11:102542134-102542156 CTAGGCATTGGCAAAGCAGAGGG - Intergenic
1088210968 11:107455976-107455998 CTGGAGATTGGAAATGCAGAAGG - Intronic
1088551949 11:111022159-111022181 CTGTGCACTTGGAAAGCAGATGG - Intergenic
1089489629 11:118874133-118874155 CTGGGCATTTGGATGGCAGAGGG - Intergenic
1090434359 11:126674547-126674569 CTTGGAATTAGGAAAGGAGATGG - Intronic
1091000667 11:131908533-131908555 CTAGTCATGGGGAAAGGAGAGGG - Intronic
1094381464 12:29848182-29848204 CTGAGCAATGGGAAATCATAAGG + Intergenic
1096329594 12:50699071-50699093 ATGTGCATTGTGAAACCAGATGG + Exonic
1097262658 12:57728194-57728216 GTGGGGGTAGGGAAAGCAGAGGG + Intronic
1099188282 12:79539403-79539425 CTGATCCTTGGGAGAGCAGAGGG + Intergenic
1100819542 12:98418645-98418667 TTGGGCAATGGGGAAGGAGATGG - Intergenic
1102288094 12:111675933-111675955 CAGGACATAGGAAAAGCAGAAGG - Intronic
1102527271 12:113520806-113520828 CTGGGCATTGGAAAAGAGCAAGG - Intergenic
1102675385 12:114654561-114654583 CTGTGCATTGGGTAGGAAGATGG + Intergenic
1103585912 12:121955646-121955668 ATGGGCATTTTGAAAGCAGATGG - Intronic
1104705776 12:130946438-130946460 CTGGGCATGGGGAATAGAGAAGG + Intergenic
1105386914 13:19938884-19938906 CTGGGCAATGGCAAAACAGTGGG - Intergenic
1105764450 13:23545400-23545422 CTAGGGATTGGGAAAGCTGGTGG + Intergenic
1105886535 13:24647449-24647471 CTGGGCCTGGGGACAGCAGCAGG + Intergenic
1107323758 13:39217478-39217500 ATGGGGGTTGGGAGAGCAGAGGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1111803498 13:93008770-93008792 CTTGGAATTAGTAAAGCAGAAGG + Intergenic
1112193640 13:97203098-97203120 CTGGACAATGGGAAAGCTGTAGG + Intergenic
1113455029 13:110442419-110442441 CTGGCCAGTGGGATGGCAGAGGG - Intronic
1113456543 13:110453250-110453272 CAGCGCTTTGGGAAAGCCGAGGG + Intronic
1115535929 14:34373386-34373408 CTCAGCATTGGGGAAGCAGGAGG - Intronic
1118117952 14:62802702-62802724 CTGGGTACTGGGAAGGCAAAGGG + Intronic
1118812920 14:69288508-69288530 CTGGGTGTTGGGAAAGCATAGGG - Intronic
1118983793 14:70736129-70736151 CTGGACAGTGGGAAGGCAGCTGG - Intronic
1119182109 14:72612263-72612285 ATGGCATTTGGGAAAGCAGATGG - Intergenic
1121566406 14:94913253-94913275 CTAAGCAGTGGGAAAGAAGAAGG + Intergenic
1122161152 14:99784926-99784948 TTGGGAAATGGAAAAGCAGAGGG + Intronic
1122459369 14:101882643-101882665 CAGGGCATTTGTAAGGCAGAAGG + Intronic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1122870539 14:104636176-104636198 CTGGGGATTGGGAGAGCTGCTGG - Intergenic
1124263625 15:28214316-28214338 CAGGGCACAGGGAAAGGAGACGG + Intronic
1124314378 15:28655429-28655451 CAGGGCACAGGGAAAGGAGACGG - Intergenic
1125042071 15:35200117-35200139 CTGGGCATTTGGCTTGCAGATGG - Intergenic
1126340739 15:47638269-47638291 GTGGGCCTTGGTAAAGAAGATGG + Intronic
1126549404 15:49909620-49909642 TTGGGCATGGGGACAGCAGGTGG - Intronic
1127250855 15:57236200-57236222 CTGGGAAGTGGGGAAGCAGATGG - Intronic
1127930544 15:63594259-63594281 CTGGGCCCTGGAAAAGCCGATGG + Intronic
1127963388 15:63906717-63906739 CGGGAGATTGGGAAAGCACATGG - Intergenic
1128118425 15:65127926-65127948 CAGGGCATTTGTAAATCAGAGGG - Intronic
1129224799 15:74162867-74162889 CTGGGCCTAGGGCAAGCAAAGGG - Intergenic
1129518094 15:76169122-76169144 CTGGGCCTTGGGAAGACGGAAGG + Intronic
1130136387 15:81185046-81185068 CTGGGCCTGTGGGAAGCAGAGGG + Intronic
1130607029 15:85327182-85327204 CTGGGCATTGGGAAAAAAAGGGG - Intergenic
1131382185 15:91973187-91973209 CTGGGAAATGAGAGAGCAGAGGG - Intronic
1132209620 15:100010338-100010360 TTGGGCATGGGGAAATCAGGAGG + Intronic
1133556026 16:6907301-6907323 CTGGGCACTGGGAATACTGAAGG - Intronic
1133733405 16:8595466-8595488 CTGGGAACTGGGAAAGGGGAAGG - Intergenic
1135920046 16:26641694-26641716 CTGGGCACTGGGAATACAGCAGG - Intergenic
1136356821 16:29749582-29749604 CTGAGCATTCGGGAAACAGAGGG - Intergenic
1136545344 16:30951149-30951171 CTGGGCCTGGGGAAAGAAGAAGG - Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1137411902 16:48235796-48235818 CTGGGGATTGGGAAAACACAGGG - Intronic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1138622666 16:58224287-58224309 CTTGGCATGGGGAAAACACAGGG + Intergenic
1139022505 16:62767961-62767983 CTGGCCATTGAAACAGCAGAAGG + Intergenic
1139486622 16:67260572-67260594 CTGAGCGGTGGGAAAGAAGAGGG + Intronic
1139707939 16:68754763-68754785 CTAGGCATTGGGGATGCAGCGGG + Intronic
1140076385 16:71702962-71702984 ATAGACATTGGAAAAGCAGAAGG - Intronic
1140508312 16:75488587-75488609 CTGGGCATTTGGAAGGGGGAAGG + Intronic
1141865870 16:86749392-86749414 CTGGGCTTTGGGCCAGCAGAAGG + Intergenic
1141920550 16:87132841-87132863 CAGGGCATTGGGAAGGCGGGTGG - Intronic
1141999960 16:87658658-87658680 GTGGGCATTTGTAAAGCAGGAGG + Intronic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1142640831 17:1285011-1285033 GTTGGCATTTGGGAAGCAGATGG + Intronic
1142969887 17:3604161-3604183 CTGGGCCTTGGACAAGGAGAAGG + Intergenic
1143101635 17:4507738-4507760 CTGTGCTTGGGGAAAGCAGGGGG + Intronic
1144220153 17:13092518-13092540 CCAGGCATTGAGAAAGCACAGGG + Intergenic
1144553437 17:16261168-16261190 CTGGGAATGTGGCAAGCAGAGGG - Intronic
1145081234 17:19895976-19895998 CTGGGCATTGGGAAAGGCTTTGG + Intergenic
1145802074 17:27694023-27694045 ATGGGCATTGGGGGAGCAGAAGG + Intergenic
1147606245 17:41775399-41775421 CTGGGCAGTAGGTAAGGAGAAGG - Intronic
1147744460 17:42686812-42686834 CTGGCATTTGGGAAAGCATACGG + Intronic
1147941219 17:44049710-44049732 CTGGGCATGTGGAAATAAGATGG - Intronic
1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG + Intergenic
1150250965 17:63704298-63704320 CTGGGCTTCGGGAGAGCAGAGGG - Intronic
1151958477 17:77392620-77392642 CCTGGCCTTGGGAAGGCAGAGGG + Intronic
1152528077 17:80900940-80900962 CTGGGCATTTGGATACCACATGG + Intronic
1152978224 18:245447-245469 CTGGTCACTGAGCAAGCAGATGG + Intronic
1153116876 18:1668455-1668477 CTAGGCACTGGCAAGGCAGATGG - Intergenic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1153939710 18:9967604-9967626 CTGGCAACTGGGAAAGTAGAAGG + Intergenic
1154164479 18:12004145-12004167 CTGCCCAGTGGGAAAGCAGCTGG - Intronic
1154194948 18:12258721-12258743 CTAGGCCTGGGGAAAGCAGGAGG - Intronic
1154366472 18:13714342-13714364 CAGAGCATTGGAAAAGAAGATGG + Intronic
1156813268 18:41277673-41277695 CAGTGCATTGTGAAAGGAGATGG + Intergenic
1157154759 18:45254858-45254880 CTGGGCTTTGCCAAACCAGAGGG + Intronic
1157479242 18:48042586-48042608 GTGGGCACTGGGAAGGCAGCAGG + Intronic
1158124236 18:54083885-54083907 CAGGGCAATGGGAATACAGAGGG - Intergenic
1159655365 18:71025957-71025979 CTGGCCTTTGTGAAAACAGATGG + Intergenic
1160497249 18:79382858-79382880 CAGGGCAGTGGGACAGAAGAAGG - Intergenic
1161332746 19:3696161-3696183 GTGGGCATTGGGCAGGAAGAGGG - Intronic
1161643218 19:5436821-5436843 CTGGCCAATGGGGACGCAGAGGG - Intergenic
1161697481 19:5777517-5777539 CTGGGCATTGGGGGAGAATAGGG + Intronic
1163030288 19:14539710-14539732 CCAGGCATGAGGAAAGCAGAGGG - Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1164336298 19:24324371-24324393 AGGGGCATTGGGGGAGCAGAAGG - Intergenic
1164650723 19:29889747-29889769 CCAGGCCTTGGAAAAGCAGATGG + Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166194644 19:41197847-41197869 CTGGGCATGGGGAAGCGAGAAGG + Exonic
1166325278 19:42046126-42046148 CAGGGCAGTGGGAAGGGAGACGG + Intronic
1167460474 19:49621822-49621844 GTGGGCCTTGGGGCAGCAGAGGG + Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1168026337 19:53646414-53646436 CTGGGTATAGAGAAAACAGATGG + Intergenic
1168428596 19:56258886-56258908 CTGGACAATGGGACAGCTGAGGG - Intronic
1168526996 19:57096700-57096722 GGGGGCACTGGGAAAGGAGAAGG + Intergenic
1168593362 19:57654584-57654606 CTGGCCATCTGGAAAGCTGATGG + Intergenic
1168681853 19:58321698-58321720 CTGGGCATTGGTAAAAGGGAAGG - Intergenic
925174133 2:1770598-1770620 CTGGGCAGAGGGGAAGAAGAGGG - Intergenic
925450174 2:3962467-3962489 CTGGGCATTGTGCTAGCTGAAGG + Intergenic
925547168 2:5029502-5029524 CTGGGCATCGGGGAAGGAAAGGG - Intergenic
926366030 2:12133821-12133843 CTGGGCTCTGGGAAGTCAGAGGG + Intergenic
926706851 2:15843262-15843284 CTGTGGGTTGGGTAAGCAGAGGG + Intergenic
926730375 2:16031535-16031557 CTTAGCACTGGGAAAGCAGACGG + Intergenic
926772673 2:16392368-16392390 ATGGACAAGGGGAAAGCAGAGGG + Intergenic
927092519 2:19722845-19722867 CTGGGAATTGGGGAATTAGAGGG - Intergenic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
928264654 2:29801251-29801273 CTGGAAATTGGGAAAGCAAATGG - Intronic
928299889 2:30115789-30115811 CTGGGCATTTGGGAAGAACATGG - Intergenic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
930441375 2:51411629-51411651 GTGGGCATGGGGAATGGAGAAGG - Intergenic
931688645 2:64816474-64816496 GTGGGCACTGGGGAAGCAGGAGG - Intergenic
932177899 2:69619420-69619442 CTGAACCTTGGGAAAGAAGAGGG - Intronic
932304689 2:70693707-70693729 CTGGGCTGAGGGAAACCAGAGGG - Intronic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932653118 2:73581462-73581484 CTGGGTAAGGGGATAGCAGAAGG + Intronic
932927448 2:75993762-75993784 CTGGGCACTGGGATACCAGGTGG + Intergenic
933038210 2:77427681-77427703 CTGGCCATAGGGAAAGAATATGG + Intronic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
934559121 2:95303217-95303239 CTGGGCATGGGGCAAGGAGTGGG + Intronic
935098033 2:99966164-99966186 CTGGGCATTAGGAAACTAGGTGG - Intronic
935727135 2:106033398-106033420 CAGGGGATTGGGGAAGAAGAGGG + Intergenic
936155309 2:110043028-110043050 GTGGGCAAAGGGAAAGCCGAGGG + Intergenic
936189371 2:110328385-110328407 GTGGGCAAAGGGAAAGCCGAGGG - Intergenic
937256950 2:120562340-120562362 CTGAGGAGTGGGAAAACAGAGGG + Intergenic
937762962 2:125627794-125627816 CTGTGCATGGGGAAAGCTGTTGG - Intergenic
937862745 2:126723692-126723714 CTGGGCAATGGTGAAGCAAAGGG + Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
941205132 2:162562639-162562661 CTGGGCTTTGAGGAAGCTGAGGG + Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
943763127 2:191631551-191631573 ATGGGCATTGGTAAATAAGAAGG - Intergenic
945452298 2:210007802-210007824 CTGGGCTTTGTTAAAGCAGCAGG - Intronic
945534688 2:211000763-211000785 CTGGGGATAGGGAAATCAAAAGG - Intergenic
946073007 2:217050503-217050525 CTGAGCATTGGGAGGGCAGCAGG - Intergenic
946471612 2:219966016-219966038 CTGGGCATCAGGAAACCAAATGG - Intergenic
947933966 2:233987573-233987595 CTGGACACTGGGAGACCAGATGG - Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1172845050 20:37925262-37925284 TTGGGCATTGGGAAGGGAAAGGG - Intronic
1173020904 20:39267457-39267479 CTGGGCATAGGAAAAGTTGAAGG + Intergenic
1173256659 20:41398589-41398611 CTGGGCTTCGGGAACTCAGAAGG - Intergenic
1173406755 20:42773056-42773078 CTGGGCACTGGGAATGAGGATGG + Intronic
1174939929 20:54915177-54915199 CATGGCATTGGAAAAGGAGATGG + Intergenic
1175870980 20:62209337-62209359 ATGGGCTTTAGGAAAGAAGATGG + Intergenic
1177625470 21:23654418-23654440 CTGAGCATTTGGAAAGTAGCTGG - Intergenic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178131208 21:29574355-29574377 CTGGGAAATGGGCTAGCAGAAGG - Intronic
1178626522 21:34223148-34223170 CTGGGCATTTGGAAATGGGAAGG + Intergenic
1178698722 21:34816059-34816081 CTGGGATCTGGGAAAGGAGAAGG + Intronic
1179510831 21:41872183-41872205 CTGGGGAATGGGATAGCAAATGG - Intronic
1179971553 21:44838695-44838717 CCAGGCCTTGGGAGAGCAGACGG - Intergenic
1181544294 22:23592298-23592320 CTGTGCACTGGGCCAGCAGAGGG + Intergenic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
1182396625 22:30040899-30040921 CTGGGCATGGGGGGCGCAGAAGG - Intergenic
1182645573 22:31806406-31806428 ATGGCCATTGGGAAAGATGAGGG - Intronic
1183732713 22:39627708-39627730 CTCGGCTTGGGGAGAGCAGAAGG + Intronic
1184885867 22:47344110-47344132 GAGGGCATGGGGAAAGCAGGGGG + Intergenic
1184968092 22:47996000-47996022 CTGGGCAGAGGGAAGGCAGTGGG + Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
950945313 3:16939890-16939912 CCGGGCATTGGGGGAACAGAGGG + Intronic
951281482 3:20755235-20755257 CTGGGAATTGGGAAAGTTGAAGG + Intergenic
951595987 3:24318617-24318639 CTGGGCATTGAGAAAGCAACAGG - Intronic
952032171 3:29156349-29156371 CTGACTATTGGGAATGCAGAAGG + Intergenic
952169758 3:30793914-30793936 CAGAGCATACGGAAAGCAGATGG - Intronic
952321773 3:32284409-32284431 CTGGGCACTGGGCTGGCAGAGGG - Intronic
952652769 3:35746206-35746228 CTAGTATTTGGGAAAGCAGATGG + Intronic
953003650 3:38957802-38957824 CTGGGCACTGGGGATGCAAAGGG + Intergenic
953022868 3:39127088-39127110 CTGGGCCTTGAGAAGGGAGAAGG - Intronic
956524535 3:70143110-70143132 CTTGGAGTTGGGAAAGCAAATGG - Intergenic
956864580 3:73356636-73356658 CAGGGAAATGGGAAAGCAGGAGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960035129 3:113094593-113094615 CTGGGCAGAGGAAAAGAAGAAGG + Intergenic
960163282 3:114373537-114373559 GTGGGCATTTGTAAAGTAGAAGG - Intronic
960424320 3:117487573-117487595 CTGGGCTGTGGCAAAGCAGCAGG + Intergenic
961235401 3:125362071-125362093 GTGGGCATGGAGAAAACAGATGG - Intronic
961325728 3:126108272-126108294 CTGGTCATTGGGCCACCAGAAGG + Intronic
961439867 3:126946236-126946258 CTGGGCTTTGGCAAGGCGGAAGG - Intronic
961821014 3:129575656-129575678 CTGGGGATGGGGGAACCAGAAGG + Intronic
962933744 3:140060566-140060588 CTCGGCAATGGGAAGGCCGAAGG + Intronic
962987036 3:140545365-140545387 CCAGGCATTGGGGAAGCTGAAGG + Intronic
964390346 3:156190203-156190225 CTGGGCACTGGGGGAGCAGGCGG - Intronic
965405217 3:168259993-168260015 CTAGGCATTGGGGATACAGAAGG + Intergenic
965694100 3:171389208-171389230 CTGGGCAGTAGGAAAAAAGATGG - Intronic
965803975 3:172523547-172523569 CTGGGCAGTAGGAAAGGGGAGGG - Intergenic
965983333 3:174720674-174720696 GTGGGCATTGGGAATGCAGATGG + Intronic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968334539 3:197901637-197901659 CTCCGCATGTGGAAAGCAGATGG + Intronic
971936704 4:33158850-33158872 GTGGTAAATGGGAAAGCAGATGG + Intergenic
972572361 4:40321873-40321895 CAGGGCACTGGGAAAACAGAAGG + Intergenic
972770619 4:42193870-42193892 TTGGGAATGGGTAAAGCAGAGGG + Intergenic
972868044 4:43258375-43258397 GTGGGCAGTGGGAGAGGAGATGG + Intergenic
973209103 4:47595805-47595827 CAGGACTTTGGAAAAGCAGACGG + Exonic
976016420 4:80560412-80560434 CTTTGGCTTGGGAAAGCAGAGGG + Intronic
977718819 4:100214773-100214795 CTGGGAAATGGGGCAGCAGAAGG - Intergenic
978074950 4:104516851-104516873 TTGGTCATGGGGAAAGCAGTTGG - Intergenic
979449930 4:120858701-120858723 CTCTGCCCTGGGAAAGCAGATGG + Intronic
981470653 4:145130940-145130962 CTGGGCATTGGCAGAGGAGGTGG - Intronic
982081246 4:151792653-151792675 CTGGCCTTTGAGAATGCAGATGG + Intergenic
982440716 4:155432778-155432800 CTGGGCTTTGGGAGAGCAGGAGG - Intergenic
984176367 4:176423109-176423131 CTGGAGATTGGAAAGGCAGAGGG + Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
986335366 5:6751120-6751142 CTGGGCATTGGCAAGGCGGTGGG - Exonic
987948208 5:24642764-24642786 CTGGGAAATGGGAAAAAAGAAGG - Intronic
988001796 5:25358775-25358797 GTGGCCATTGGGAAAGGGGAGGG + Intergenic
988129859 5:27089903-27089925 CAGAGCATGGGGAAACCAGAGGG + Intronic
991155042 5:63424240-63424262 CTATGCATTTGGAAAACAGAGGG + Intergenic
993278813 5:85898410-85898432 CTCTGCCTTTGGAAAGCAGATGG - Intergenic
993503388 5:88685450-88685472 CTGGGCAGTGGGGAAACCGACGG - Intergenic
994584740 5:101692532-101692554 CTGGGTATTGGGCAAGGGGAGGG - Intergenic
994675374 5:102814824-102814846 ATGGGGGTTGGGAAAGCATAGGG - Intronic
994690837 5:103017717-103017739 GGGGGCTTTGGCAAAGCAGAGGG + Intronic
995542034 5:113195058-113195080 CTGTGCACTGGGAAAGCCTAGGG - Intronic
995559712 5:113367606-113367628 TTGGGCATAAGGAAGGCAGAGGG + Intronic
996216457 5:120872431-120872453 CTGGGCATTGTGTAAGAAAAAGG - Intergenic
997038883 5:130227793-130227815 ATGGGAATTGGGAAAGAGGAAGG - Intergenic
997737500 5:136224790-136224812 CTGGGCCCTGTGGAAGCAGAGGG - Intronic
997781696 5:136666204-136666226 CTGGTCACTGGGAAGGAAGATGG - Intergenic
998416830 5:141952259-141952281 CTGGGCATAGGGAAAGAATGGGG + Intronic
998511646 5:142718923-142718945 CGGGGACTTGGGAAAGCAGAGGG + Intergenic
999010867 5:148038371-148038393 CTGGGCAATGTGACAGCAGCTGG + Intronic
999539944 5:152560385-152560407 CTGGGCATTGGGAATATCGATGG - Intergenic
1000028271 5:157379020-157379042 CTGGGAATTGGGAATGCAGGTGG - Intronic
1000157555 5:158566602-158566624 CTGGGCACTGGGAATGCTGATGG - Intergenic
1000341583 5:160280906-160280928 CTGTGCTTAGTGAAAGCAGATGG - Intronic
1001419604 5:171576754-171576776 CTGGGCAGTGGGGAATCAGCAGG - Intergenic
1002100338 5:176854542-176854564 CTGGACCCTGGGGAAGCAGAGGG - Intronic
1002399351 5:178982922-178982944 CTGGGCAGTGCCAAAGAAGATGG + Exonic
1002690089 5:181044471-181044493 GTGGGCGTTGGGAAGGCAGGGGG + Intronic
1003506046 6:6741070-6741092 CTGGGCATTGGTGATGGAGATGG + Intergenic
1003881198 6:10481432-10481454 CTGAGCCTTGGGAAAGGAGGAGG - Intergenic
1003886457 6:10525528-10525550 AAGGGCATTGGGAAAGCTGGAGG + Intronic
1004017853 6:11748724-11748746 CTGAGCCATGGGAGAGCAGATGG + Intronic
1005619813 6:27609387-27609409 CTAGGCACTGGGGAAGCAGCAGG + Intergenic
1005754870 6:28917218-28917240 GTGGGCACTGAGTAAGCAGATGG - Intronic
1006092985 6:31639155-31639177 CTGGGCATTGGGGAAGCGCTGGG + Exonic
1006213612 6:32419119-32419141 TTGGGCATTGGTAAATCAAACGG + Intergenic
1007631933 6:43277480-43277502 CGGGGCTTTGGGAATGCAGCTGG - Intronic
1007769686 6:44183001-44183023 CTGGTTATTGAGAAAGCAGGTGG + Exonic
1008082082 6:47205120-47205142 ATGTGCATTGGTAAAGAAGAAGG - Intergenic
1009400419 6:63248191-63248213 CTAGGCATTGGGACAGGGGATGG + Intergenic
1009634008 6:66240058-66240080 CTTGGCATTGAAAAAACAGAAGG + Intergenic
1009823713 6:68839608-68839630 CTGGCCATTAGAAAAGCAAATGG + Intronic
1010138665 6:72586448-72586470 CTGCCCAGTGGGACAGCAGAGGG - Intergenic
1010186758 6:73153252-73153274 TTTGGAAGTGGGAAAGCAGATGG - Intronic
1011807303 6:91086433-91086455 ATGGGCATTTGGAAAGGAGACGG + Intergenic
1013932810 6:115555024-115555046 CAGGGAAGTGGGAGAGCAGAAGG + Intergenic
1014424960 6:121292856-121292878 CTGGGCAGGAGCAAAGCAGAAGG + Intronic
1017410625 6:154163918-154163940 CAGTGCAGTAGGAAAGCAGAGGG + Intronic
1017990139 6:159480620-159480642 TAGGGCATGGGGACAGCAGAGGG + Intergenic
1018487103 6:164252014-164252036 CTGGGTATTGGAAATACAGAAGG + Intergenic
1018937228 6:168281469-168281491 CTGGGAAATGTGAAAGCAGGTGG + Intergenic
1019279123 7:191531-191553 CTGGGCACTGTGGAAGCAGCCGG + Intergenic
1019315603 7:383710-383732 CTGAGCATTGAAAAATCAGATGG + Intergenic
1019884749 7:3893960-3893982 CTGGCCATTGGGAAACCAGCAGG - Intronic
1020033000 7:4945956-4945978 CTGGTCTTTGGGAAAGGAGTTGG - Intronic
1020817537 7:12923982-12924004 CCTGGGAGTGGGAAAGCAGAGGG + Intergenic
1021433229 7:20584980-20585002 ATGGGGGTTGGGATAGCAGAGGG + Intergenic
1021664114 7:22957583-22957605 ATGAGGATTGGGAAAGGAGAAGG - Intronic
1021986787 7:26105121-26105143 CTAGGCATTGGGAATGCTCAGGG - Intergenic
1022388375 7:29922820-29922842 CTTAGCATTGGGAAGACAGAGGG - Intronic
1023870912 7:44262628-44262650 CTGGGCACTGGCTCAGCAGAGGG + Intronic
1024185635 7:46945664-46945686 CTGGGCACTGGAAATGCAGCAGG + Intergenic
1024634758 7:51277768-51277790 CAGGGCATTGTGAGAGCAGGGGG + Intronic
1024944608 7:54796245-54796267 CAGGGCATAGAGAAAGCAGAGGG + Intergenic
1026882421 7:73915959-73915981 ATGGGCATAGTGAAAGAAGAGGG - Intergenic
1027540707 7:79461034-79461056 ATGTGCATTTAGAAAGCAGAGGG - Intergenic
1030988759 7:116274050-116274072 GTGGGAATTGGGATAGCAAAGGG + Intergenic
1031470661 7:122165435-122165457 CTGGGGACTGGCAAAGCAGTTGG + Intergenic
1031489610 7:122370630-122370652 GAGGGCATTGGGTAAGGAGAGGG + Intronic
1031491619 7:122396694-122396716 TTGGGCAAGGGGACAGCAGAAGG - Intronic
1032285785 7:130537549-130537571 CTGGGAGCTGGGAGAGCAGAGGG + Intronic
1032286548 7:130541975-130541997 CTGGGAGCTGGGAGAGCAGAGGG + Intronic
1032341656 7:131079500-131079522 TTGGGAAGTGGGAAAGCAGCAGG - Intergenic
1032949031 7:136886324-136886346 CTGGGCTTTGGGTAAACAGTAGG + Intronic
1033045881 7:137961866-137961888 CTGAGCATTGGGCATGAAGAGGG - Intronic
1034314170 7:150114640-150114662 ATGGGCACTGGGAAAGAAAAGGG + Intergenic
1035013647 7:155743849-155743871 ATGGGCATCGGGGAAGCAGACGG - Intronic
1035092687 7:156327607-156327629 CTGTGCATTGGAAATACAGATGG - Intergenic
1035312084 7:157975812-157975834 CTGGGCACTGGGGATGCAGAGGG + Intronic
1035484905 7:159215274-159215296 CTGGAAATGGGAAAAGCAGAGGG + Intergenic
1036547142 8:9782802-9782824 CTAGGCATGGAGAAAGAAGAGGG - Intergenic
1036795182 8:11750533-11750555 CTGTTCATTTGGAAAACAGAAGG + Intronic
1037824724 8:22154522-22154544 AGGGGCAATGGGAAAGCAGAAGG - Intronic
1039135876 8:34322313-34322335 CTGGGCAGTGGGAACACTGAAGG - Intergenic
1041354999 8:56991055-56991077 CTGGGCATTAGGAGAGGGGAAGG + Intronic
1042679634 8:71368446-71368468 CAGGGGAGTGGGTAAGCAGAAGG + Intergenic
1043300405 8:78723634-78723656 TTGGCCTTTGTGAAAGCAGAAGG - Intronic
1044151644 8:88784509-88784531 ATGGACAATGGGAAATCAGAGGG + Intergenic
1044838414 8:96317240-96317262 CTGGGCATGGGAAAGGCACAAGG - Intronic
1047317675 8:123749047-123749069 CTGGGATGAGGGAAAGCAGATGG + Intergenic
1047715234 8:127589179-127589201 CTCGGCATTGGTGATGCAGATGG - Intergenic
1049178008 8:141206032-141206054 CTGGGCTTTGGGAACACAGGTGG - Intergenic
1050165435 9:2760315-2760337 CCAGGAATTGGAAAAGCAGAAGG - Intronic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1052162381 9:25280742-25280764 CTGGGGATGGGGAAAGGAGGAGG + Intergenic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1054800430 9:69342907-69342929 CTGGGCATTGGGTAAGAACTTGG + Intronic
1055131383 9:72778923-72778945 CTGCGTGTTGGCAAAGCAGAGGG - Intronic
1055569381 9:77601016-77601038 CTGCGCACTGGGAAAAAAGAAGG + Intronic
1056261987 9:84858150-84858172 CTGGGTATTGGGGAAGGGGAAGG - Intronic
1057196782 9:93119914-93119936 CTGGGCATTGGGACTGCAGGGGG + Intergenic
1057211126 9:93201668-93201690 CTGGGCACTTGGGAAGCACATGG - Intronic
1057269440 9:93641188-93641210 CTGGACATGGGGAAAGCATTTGG - Intronic
1058018612 9:100066651-100066673 CAGGGCATTGGGACTTCAGATGG - Intronic
1058528127 9:105880101-105880123 CTGGGCATTGGCAGTGGAGATGG + Intergenic
1058919968 9:109604014-109604036 CTGGGAAGTGGGAAAGAAGTAGG - Intergenic
1059009907 9:110445744-110445766 ATGGGAAATGGGAAAGTAGAGGG - Intronic
1059306727 9:113359488-113359510 CAGGGCATAGGGAAAGCTGCTGG + Intronic
1059331068 9:113536219-113536241 CTGGGCAGTGGGGCTGCAGAGGG + Intronic
1061149781 9:128822115-128822137 TTGGGCATAAGGAAAACAGAGGG + Exonic
1061531292 9:131215614-131215636 TTGGGCCTTGGGAGAGAAGAGGG - Intronic
1061986970 9:134135635-134135657 GTGGGCATTTGGAAAGCACCTGG - Intronic
1062669174 9:137696406-137696428 CTGGGCTTTCCTAAAGCAGAAGG + Intronic
1186997658 X:15140862-15140884 CTGGGGATGGGGAACCCAGAAGG + Intergenic
1187187728 X:17003128-17003150 TAGGGCATAGGGAAAGGAGATGG + Intronic
1187626031 X:21114790-21114812 TTGGCTATTGGGAAAGCTGAAGG + Intergenic
1188485926 X:30682203-30682225 CTGGGCAATGAGAAATTAGATGG + Intronic
1189783828 X:44542301-44542323 CGGGCCTTTGGGAAAGCAGATGG - Intronic
1189991537 X:46600138-46600160 GTGGGCTTTGGAGAAGCAGAGGG - Intronic
1190507869 X:51145539-51145561 TTCTGCTTTGGGAAAGCAGAGGG - Intergenic
1190893826 X:54596787-54596809 CTCTGCATTTGGAAAGGAGAGGG - Intergenic
1191717573 X:64204238-64204260 GTGGGCATGGGCAAGGCAGAGGG - Intronic
1191894942 X:65982417-65982439 CTGGGCAGAGGAAAAGCAGCTGG - Intergenic
1192221846 X:69202769-69202791 CTGTGCATTTGGCAAGCAGCAGG + Intergenic
1192234171 X:69285578-69285600 CAGGGCAGAGGGAAAGGAGAGGG + Intergenic
1193953883 X:87835072-87835094 CTGGGGATTGGGAAGTCAGGTGG + Intergenic
1194730075 X:97442636-97442658 ATGTCCACTGGGAAAGCAGATGG - Intronic
1196202399 X:112900293-112900315 TTTGGCATTGGGAATGAAGAAGG + Intergenic
1196203545 X:112913076-112913098 TTTGGCATTGGGAATGAAGAAGG + Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1197167176 X:123391489-123391511 CTGGGGATGGGGACATCAGATGG + Intronic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1201917949 Y:19203087-19203109 TTGGGGAGTGGGAAGGCAGAAGG - Intergenic