ID: 1078442253

View in Genome Browser
Species Human (GRCh38)
Location 11:11377788-11377810
Sequence GAGGAAAAGACAGATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1577
Summary {0: 1, 1: 0, 2: 15, 3: 198, 4: 1363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078442248_1078442253 18 Left 1078442248 11:11377747-11377769 CCTTGGGCTTTGATTTTGCTAAA 0: 1
1: 0
2: 2
3: 22
4: 216
Right 1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG 0: 1
1: 0
2: 15
3: 198
4: 1363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078442253 Original CRISPR GAGGAAAAGACAGATGAGGA TGG Intronic
900031452 1:375790-375812 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900052003 1:603990-604012 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900228845 1:1545844-1545866 GAGGGCAAGACAGTCGAGGAGGG + Intronic
900701217 1:4049719-4049741 GAGAAAAAGAGAGAGGAAGATGG + Intergenic
900738817 1:4317910-4317932 AAGGATAAGATAGATGAAGAGGG + Intergenic
900748717 1:4379727-4379749 TAGGAAACCACAGATGAGCACGG - Intergenic
900790880 1:4679727-4679749 GAGGCAAGGACACATGTGGATGG - Intronic
900821246 1:4890589-4890611 GAGGAATAAACAGTTAAGGAGGG - Intergenic
900941445 1:5801267-5801289 GAGGAAATGCCACATGAAGATGG + Intergenic
901200761 1:7465899-7465921 GAGAATAAGACAGGTGAAGAGGG + Intronic
901264407 1:7899074-7899096 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
901445239 1:9304381-9304403 GAGGGAGAGACAGATGAGAAAGG - Intronic
901481509 1:9528406-9528428 GAAGGAAAGCCAGATGTGGAAGG - Intergenic
901585667 1:10289500-10289522 GAGGAAAGAACACATGGGGAAGG - Intronic
901672608 1:10865073-10865095 GAGAGAAAGACAGAAAAGGAAGG + Intergenic
901689280 1:10962034-10962056 GAGGAAGAGAAAGGAGAGGAAGG - Intronic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
901905281 1:12403851-12403873 CATGAAAAGACAGCTGAGCAAGG + Exonic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902653840 1:17854073-17854095 GGGGAAAAGAAAGAAGAGGAAGG - Intergenic
902789402 1:18756413-18756435 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
902870977 1:19313292-19313314 GTGGAAGAGAGAGAAGAGGAAGG - Intronic
903640870 1:24859322-24859344 GAGGTAAAGACAGAAGTGCAGGG + Intergenic
904123813 1:28222130-28222152 GATGAAAAGAGTTATGAGGATGG + Intronic
904239209 1:29133207-29133229 GAAGAAAAGAAAGAAAAGGAAGG + Intergenic
904302786 1:29566193-29566215 GTGGAAAAGAGAGGTGAGGAAGG + Intergenic
904331064 1:29758075-29758097 GAGGGGAAGGCAGGTGAGGACGG + Intergenic
904448576 1:30596383-30596405 GAGGAACAGAGAGATGATAAGGG - Intergenic
904624633 1:31795522-31795544 GAGGAAGAGAGAGAGGAGGTGGG - Intronic
904938974 1:34151619-34151641 GAGGAAAGGAGAGAGGCGGAAGG + Intronic
904999811 1:34659359-34659381 TGGAAAGAGACAGATGAGGAAGG - Intergenic
905002113 1:34680672-34680694 GAGGAATAGAAAGATGGGGGAGG + Intergenic
905034646 1:34909760-34909782 GAGGGAAAAACAAGTGAGGAAGG + Intronic
905062014 1:35148309-35148331 GAGGAAGAGACAGACAAAGAGGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905575798 1:39043701-39043723 AAGAAAAAGAAAGAAGAGGAAGG + Intergenic
905895395 1:41542563-41542585 GAGGAAGAGGAAGATGATGAAGG + Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906371738 1:45259573-45259595 GAGGAAGAGAGAGAGGGGGAAGG - Intronic
906519606 1:46459294-46459316 GAGGACAAGGCAGAGCAGGATGG - Intergenic
907325545 1:53636605-53636627 GAAGAGAAGTCAGAAGAGGAAGG + Intronic
908397786 1:63742095-63742117 GAAGAAAAGGAAGAGGAGGAAGG + Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908855497 1:68422422-68422444 GAGGTAGAGACAGAGGAAGAAGG - Intergenic
909319361 1:74263724-74263746 GAGGAATGGCCAGATCAGGAAGG + Intronic
909330181 1:74400190-74400212 TAGGAATAGACATCTGAGGAAGG + Intronic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909516172 1:76509778-76509800 GAGGAAAAGATATGTGAGAATGG - Intronic
909779060 1:79520066-79520088 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
909779082 1:79520191-79520213 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
910080045 1:83330904-83330926 GAGGCAGAGAAAGATAAGGATGG - Intergenic
910106460 1:83636334-83636356 GAGGGAAAGAAAGTGGAGGAAGG + Intergenic
910144584 1:84064889-84064911 GAGGGAAAGAGAGAAGAGGGAGG - Intergenic
910376638 1:86579264-86579286 AAGGAAAAGACAAGTGAAGAAGG + Intronic
910397010 1:86803587-86803609 GAGGAAAAGACAGACAAAGAGGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911102905 1:94107926-94107948 GATGAGAAGGCAGATGAGCACGG - Intronic
911668864 1:100586057-100586079 GAGGGAGAGAGAGATGAGTATGG - Intergenic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
911992128 1:104712154-104712176 GAGGGGAAGACAGAGGAAGAAGG - Intergenic
912168553 1:107069471-107069493 GAGGAAAGGAGAAAGGAGGAAGG + Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912662357 1:111543669-111543691 GAGGAAAAAGGAGAGGAGGAGGG + Intronic
912798386 1:112706548-112706570 GAGGATAAGGGAGATGGGGAAGG - Intronic
913715533 1:121530499-121530521 GGGGAAAAGACAGAGAAGGAGGG + Intergenic
914513431 1:148353912-148353934 GAGGAAAAGGGAGAGGAGGAGGG - Intergenic
914801273 1:150964385-150964407 GAGGAAACGACAGTTCAAGAAGG - Exonic
915468734 1:156113544-156113566 GAGGAAAGTAGAGATGAGTATGG + Intronic
915656826 1:157367581-157367603 GAAGAAAACAGAGAGGAGGAGGG - Intergenic
915732892 1:158066774-158066796 GAGCAAAAGACAGAGCGGGAAGG - Intronic
915897041 1:159820180-159820202 GAGGAAGAGAAAGATGAGGATGG - Intergenic
916026562 1:160838305-160838327 GGAGAAAAGATAGATGGGGAAGG + Intronic
916055830 1:161068540-161068562 GAGGAAATGACAGATTGGGGTGG + Intronic
916123889 1:161552063-161552085 GAGAAAAGGAGAGAAGAGGAGGG - Intergenic
916133773 1:161633425-161633447 GAGAAAAGGAGAGAAGAGGAGGG - Intronic
916411808 1:164553571-164553593 GTGAACAAGACAGATGAGGTTGG + Intergenic
916491117 1:165303472-165303494 AAGCACAAGACAGATGAGAAGGG + Intronic
916550969 1:165849523-165849545 GAGGTGAAGTGAGATGAGGAAGG + Intronic
916556101 1:165895687-165895709 GAGGAAAGGACAGAAGGGGAAGG - Intronic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
916967215 1:169961666-169961688 GAGGAGGAGAAAGAAGAGGAGGG - Intronic
917081637 1:171261826-171261848 AAGGAAAAGAGAGATAAGGCAGG + Intronic
917304029 1:173608821-173608843 GAGGAGGAGAGAGAAGAGGAGGG + Intergenic
917454241 1:175172100-175172122 GATGAAAAGAGAGAAAAGGAAGG - Intronic
917494027 1:175523990-175524012 GAGAAAAAGAGAGAAGAGGGAGG - Intronic
917525023 1:175780810-175780832 GAGGACAAGAGAGAAGGGGAAGG + Intergenic
917680260 1:177358780-177358802 GAGAGAAAGATAAATGAGGAAGG + Intergenic
917763653 1:178193577-178193599 GAGGGAAAGAAAGAAAAGGAAGG - Intronic
918464023 1:184803768-184803790 GAGGAAAAGAGAGGTGAAGTGGG - Intronic
918531913 1:185532174-185532196 GAGGGGAAGACAGAAGACGAGGG - Intergenic
918787917 1:188788765-188788787 GAAGAAAAGAGAGAGGAGGATGG + Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
918946041 1:191066559-191066581 GAGAAGAAGACAGCTGTGGAAGG + Intergenic
919082842 1:192887287-192887309 AATGAAAAGACACATGGGGAAGG + Intergenic
919412288 1:197260190-197260212 GAGGAAGAGGAAGAAGAGGAAGG + Intergenic
919850040 1:201666415-201666437 GAAGAAAAGACAGATGGGGTGGG + Intronic
920136608 1:203774448-203774470 GAGGACAAGACAGATGATCCCGG + Exonic
920283742 1:204863869-204863891 AAGGAAAAGAAAGAAAAGGAAGG + Intronic
920374878 1:205502894-205502916 GGGGACAAGAGAGAGGAGGAAGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920858646 1:209686191-209686213 GAAGGAAAGGCAGAGGAGGAGGG + Exonic
920922426 1:210309275-210309297 GAGGAAAGGAAAGGAGAGGAAGG - Intergenic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921597040 1:217065697-217065719 GAGGAAAAGACAGACATGCATGG + Intronic
921794142 1:219323456-219323478 GGGGCACAGACAGATGAGAAGGG - Intergenic
922020705 1:221701289-221701311 TAGGGAAAGAGAGATGAGGAAGG - Intergenic
922436690 1:225614395-225614417 GACGAAGAGACACATGGGGAAGG + Intronic
922690002 1:227680723-227680745 GAGGAAGAGACAGACAAAGAGGG + Intergenic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922994893 1:229948224-229948246 GACAGAAAGAGAGATGAGGAGGG + Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923127776 1:231047368-231047390 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127794 1:231047441-231047463 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127812 1:231047514-231047536 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127830 1:231047587-231047609 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923209889 1:231794132-231794154 TAGGAAAAGAGAGAGAAGGATGG - Intronic
923404364 1:233645445-233645467 GGGGAAGAGACAGAGGGGGAAGG + Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
924387407 1:243511495-243511517 GAGGAGAAGACATATAGGGAAGG + Intronic
924707411 1:246511322-246511344 GAAGAAAAGGCACAAGAGGAAGG + Intergenic
924841428 1:247713742-247713764 GAGGGTAGGACACATGAGGATGG - Intergenic
924859236 1:247904376-247904398 GAGGAAGAGACAGACAAAGAAGG - Intergenic
924956178 1:248929664-248929686 GTGGAAAAGACTAATGATGATGG - Intergenic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1062902785 10:1158398-1158420 GAGGAAAAGAGAGAAAGGGAGGG - Intergenic
1063037417 10:2300226-2300248 GAGAGAAAGACGGCTGAGGAGGG - Intergenic
1063103398 10:2971442-2971464 AAGAAAAGTACAGATGAGGAGGG + Intergenic
1063194451 10:3728084-3728106 GAGAAAATGACAGTTGAGGAGGG - Intergenic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063744704 10:8867310-8867332 GAGGAAAGGAGAGAAGGGGAGGG - Intergenic
1063802738 10:9599049-9599071 GAGGAAGAGGAAGAAGAGGAAGG - Intergenic
1063948732 10:11202893-11202915 GAGAGAGAGAGAGATGAGGATGG - Intronic
1063948855 10:11203995-11204017 GGGGAGAGGACAGAAGAGGAGGG + Intronic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064056909 10:12105716-12105738 GAGGAAAAGATAAAAGAGGCTGG - Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064581167 10:16794432-16794454 AAAGAAGAGACAGAGGAGGAAGG - Intronic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065205211 10:23350867-23350889 GAGGAAGAGGAAGAAGAGGAAGG - Intergenic
1065469008 10:26057246-26057268 GAGGAAAGGACAACTTAGGATGG + Intronic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065967022 10:30778932-30778954 GAGGAAGAGGAAGAAGAGGAAGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066129736 10:32381298-32381320 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1066238268 10:33507960-33507982 GAGTAAAAGACAGAGAAGGAGGG - Intergenic
1066347810 10:34606343-34606365 GAGGAGGAGAAAGATGAGGCTGG + Intronic
1066521660 10:36226690-36226712 GAGGAAAGGACAGGAGAGCAAGG - Intergenic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066705004 10:38167907-38167929 GAGGCAGAGAAAGATGAGGTGGG + Intergenic
1067070438 10:43126968-43126990 GAGGAAAAAACAGATCAGGGCGG + Intronic
1067191677 10:44075112-44075134 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067501459 10:46808679-46808701 GAGGCAGAGAAAGATGAGGTGGG + Intergenic
1067542518 10:47166221-47166243 GAGCAAAAGCCAGAAGGGGAGGG + Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1067992998 10:51236949-51236971 GATGTGAAGACAGATGTGGAAGG + Intronic
1068064907 10:52117713-52117735 GATTAAAAGACAGAGGAAGAAGG - Intronic
1068131200 10:52897444-52897466 GAGCCAAAGAGAGATCAGGAAGG - Intergenic
1068327116 10:55506558-55506580 AAAGAAAAGTCAGATGACGAAGG + Intronic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1068837649 10:61571820-61571842 GAGGAACAGAATGATAAGGATGG - Intergenic
1069149422 10:64938598-64938620 GAAGAAGAGAGAGAAGAGGAGGG - Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069311515 10:67043708-67043730 GATGAAAAGACATATAAAGATGG - Intronic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069493088 10:68878291-68878313 AAGTAAAACTCAGATGAGGAAGG + Intronic
1069598901 10:69690568-69690590 GGCAAAAAGACAGATGAGGAGGG - Intronic
1070324310 10:75377985-75378007 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070580745 10:77717307-77717329 GAGGAAGAGAGAGAGGAGGGAGG - Intergenic
1070737607 10:78875020-78875042 GAAGAGAAGAGAGATGAGGGAGG - Intergenic
1070802381 10:79251206-79251228 GTGGAGAAGACAGGAGAGGAGGG - Intronic
1070812186 10:79303981-79304003 GAGGCACAGACAGGTGAGGATGG - Intronic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071207552 10:83298807-83298829 GAGGAAAAGAAGGAAGAGAATGG + Intergenic
1071391370 10:85178412-85178434 GAGGAAGGGACAGAGGGGGAGGG + Intergenic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072475455 10:95755877-95755899 GAGGGAGAGAGAGATGAAGAGGG + Intronic
1072526107 10:96272898-96272920 GAGGAGGAGACAGAGGAGGAGGG + Intergenic
1072616280 10:97050674-97050696 GAGGCACAGCCAGATGTGGATGG - Intronic
1072711830 10:97720793-97720815 AAAGAAAAGAGAGATTAGGATGG - Intergenic
1072752793 10:97995320-97995342 GGGTATAAGACAGATGAGGAGGG - Intronic
1073109249 10:101050945-101050967 GAAGACAAGAAAGATGAGGTGGG - Intergenic
1073147035 10:101287905-101287927 GAGGAAAAGAGAGGTCAGGGTGG - Intergenic
1073300103 10:102465983-102466005 GAGGAAAAGTCAGAAGATGGGGG - Exonic
1073384659 10:103114965-103114987 GAGGAAAGGACAAATGATAATGG - Intronic
1073780391 10:106832069-106832091 GAGAAAAAGATAGATTTGGAAGG - Intronic
1073836110 10:107444742-107444764 GAGCAAGAGAGAGGTGAGGAAGG - Intergenic
1073855266 10:107666241-107666263 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1073979746 10:109141418-109141440 GAGGAAGAGAGAGATGGGGGAGG - Intergenic
1074139532 10:110659807-110659829 GAGGAAGAGGAAGAAGAGGAAGG - Intronic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074305957 10:112278726-112278748 GAGGGGAAGACAGATAAGGGAGG + Intergenic
1074353857 10:112763995-112764017 GAGAAAAAGAGAGAGGTGGAAGG + Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074742460 10:116498550-116498572 GAGGAAGAGACAGACAAAGAGGG - Intergenic
1074742469 10:116498686-116498708 GAGGAAGAGACAGACAAAGAAGG - Intergenic
1074931292 10:118128806-118128828 AAGGAAAAGTCAGATAAGAATGG - Intergenic
1075065623 10:119287243-119287265 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1075065647 10:119287326-119287348 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1075622288 10:123936822-123936844 GAGGAAGAGGAAGATGAGGAAGG - Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076198396 10:128538236-128538258 GAGGAAGACACAGATGTGGCTGG + Intergenic
1076241625 10:128912926-128912948 GAGGATAAAACAAATTAGGAAGG + Intergenic
1076318947 10:129564389-129564411 GAGGAAGAGAAGGAGGAGGAGGG - Intronic
1077003902 11:341656-341678 GAGGAAGAGACAGAAGGGGGAGG - Intergenic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077469300 11:2749328-2749350 GGGGCAAGCACAGATGAGGATGG + Intronic
1077841156 11:5976149-5976171 GAGGAAAAGGGAGAGAAGGAAGG + Intergenic
1078099300 11:8320363-8320385 GAGAAAAAGAGAGAGGTGGAGGG + Intergenic
1078280778 11:9898945-9898967 GAGGAAAATCAAGATGGGGAAGG + Intronic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078483431 11:11700302-11700324 CTGGAAGAGACAGAAGAGGAGGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078895868 11:15596631-15596653 GGAGAAAAGAAAGAAGAGGAAGG + Intergenic
1078916240 11:15781409-15781431 AAGGAAAAGAGAGACCAGGAAGG - Intergenic
1079061332 11:17251531-17251553 GAGGAGAAGACAGGTCAGGGAGG + Intronic
1079602742 11:22329470-22329492 GATGGAAAGAGAGATGAAGAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080332260 11:31153229-31153251 GGAGAAGAGGCAGATGAGGAGGG - Intronic
1080441669 11:32300029-32300051 GTGGGAGAGACAGAGGAGGAGGG + Intergenic
1080658957 11:34280481-34280503 GAGGAAAAGAGAGAGAAAGAGGG - Intronic
1080691887 11:34565183-34565205 CAGGACAAGACAGGTGAGAAGGG + Intergenic
1080926389 11:36760969-36760991 GAGGACAGTACAAATGAGGATGG - Intergenic
1080969223 11:37250063-37250085 AAGGAAAAGAAACATGTGGAAGG + Intergenic
1080993300 11:37568687-37568709 GAGGCCAAGCCAGATGAGGGAGG - Intergenic
1081082956 11:38766425-38766447 GAGGAGAAGAGAGAGGGGGAGGG + Intergenic
1081146320 11:39565317-39565339 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1081251110 11:40835142-40835164 GAGGGAAAGAAATATCAGGATGG - Intronic
1081424673 11:42912582-42912604 GAGGAAAAGGAAGAAAAGGAAGG - Intergenic
1081490158 11:43561446-43561468 GAGCAAAAGGCAGTTGATGAAGG - Intronic
1081575210 11:44314879-44314901 AAGGAAAAGAGAGAGAAGGAAGG - Intergenic
1081759563 11:45567818-45567840 GAGGACAGGACATATGAGCAAGG - Intergenic
1081762632 11:45587220-45587242 GAAGAAAAGGCAGATGAAGTAGG - Intergenic
1081861300 11:46334579-46334601 GAGGAAGGGACAGAAGGGGAGGG + Intronic
1081867406 11:46367263-46367285 GAGGAGAAGACAGCTGAGGAGGG - Intronic
1082680799 11:56166550-56166572 AAGGAAAAGATGGATGAGAAGGG - Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1083082338 11:60107364-60107386 GAGGAATAGACAGAAAAAGAAGG - Intergenic
1083249584 11:61457194-61457216 GAGGGAATGCCAGATGATGAAGG - Intronic
1083301374 11:61741137-61741159 GAGGACAGGACAGAGGAGGCTGG - Intronic
1083380672 11:62265810-62265832 GAGGCAAGGGCAGAGGAGGAGGG + Intergenic
1083598570 11:63932210-63932232 GAGGAAGAGGCAGCGGAGGAGGG + Intergenic
1083768552 11:64853851-64853873 GAGGCAGAGCCAGGTGAGGAAGG + Exonic
1084110063 11:67008261-67008283 GAGGAAAAATCAGATTAAGAAGG - Intronic
1084173357 11:67410945-67410967 GGAGAAACGACAGATAAGGAAGG - Intronic
1084207652 11:67605311-67605333 CAGTTAGAGACAGATGAGGAAGG + Intronic
1084433550 11:69124633-69124655 GAGGCTAAGTCAGAGGAGGAGGG + Intergenic
1084559523 11:69895102-69895124 GAGGACAAGCCAGCTTAGGAAGG - Intergenic
1084705049 11:70811172-70811194 GAGGAAAAATCAGATGAACAAGG + Intronic
1084762072 11:71280266-71280288 GAGGAAAAGGCAGACCAGGGTGG - Intergenic
1084989903 11:72913044-72913066 GAGGAAAAGAGAGAAGGGGGAGG + Intronic
1085170346 11:74444515-74444537 GGAGAAAAGACAGAAGAGGAAGG - Intergenic
1085239603 11:75041511-75041533 GAGGAAGAGACAGAGGCGAAAGG + Intergenic
1085308296 11:75500790-75500812 GAAGAAAAGGGAGATGGGGAGGG - Intronic
1085324453 11:75595820-75595842 GAGGGAAAGAGAGATGAAGCAGG - Intronic
1085556886 11:77431469-77431491 GAGGAAAAGACCACTGAAGAGGG - Intronic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085728824 11:78979006-78979028 GGGGAAATGACAGAAGAGAAAGG + Intronic
1085771742 11:79331615-79331637 GAGGAAAACAAAGAGCAGGAGGG + Intronic
1085795795 11:79538332-79538354 GAGGGAAAGACAGTTTTGGAAGG - Intergenic
1085998684 11:81952728-81952750 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1086138601 11:83468792-83468814 GAAGAGAAGATAGATGAGAAGGG - Intronic
1086502192 11:87464819-87464841 GAGGAGAAGACACATGGGGAGGG + Intergenic
1086781873 11:90917037-90917059 TAGGAAAAGACAGAGAAGAAAGG - Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087031053 11:93704622-93704644 GAGGAAGAGAAAGATCATGAGGG - Intronic
1087118731 11:94550598-94550620 GAGGAAAAGAAAGATGGGGGTGG + Intronic
1087229340 11:95642156-95642178 AAGGAAGAGAGAGAGGAGGAAGG + Intergenic
1087537322 11:99465841-99465863 GAGGAAGAGAGAGAAGGGGAAGG + Intronic
1087882707 11:103437362-103437384 GATGAAAAGACAGAAGAACAAGG - Intronic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088443684 11:109900790-109900812 AAGGAAAAGAGAGGAGAGGAGGG + Intergenic
1088741787 11:112773560-112773582 GAGGAGAGGAGAGATGAGGCTGG + Intergenic
1089064191 11:115650058-115650080 GAGGGAAGGACATTTGAGGATGG - Intergenic
1089136358 11:116252394-116252416 GAGGAAGAGCCAGCTGAGAAAGG - Intergenic
1089170182 11:116506421-116506443 GAAGAAGAGAAAGATGAGGAGGG - Intergenic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1089274245 11:117323245-117323267 GAGGAAAAGAGAGCAGAAGATGG - Intronic
1089330277 11:117684598-117684620 AAAGAAAAGACAGATATGGATGG + Intronic
1089400553 11:118161883-118161905 GAGGAAGACACAGATGGGGGTGG + Intergenic
1089436519 11:118473473-118473495 GAGGAAGAGACAGAAGACGGGGG - Exonic
1089459392 11:118643866-118643888 GAGGAAGAGCCAGAGGAGGAGGG - Exonic
1089474909 11:118751803-118751825 AAGGAAAAGAAAGAAGAGAAGGG - Exonic
1089537858 11:119171623-119171645 GGGAAAAAGGCAGCTGAGGAAGG - Intronic
1089658202 11:119967743-119967765 GAGGAAGAGAGAGAGGGGGAAGG - Intergenic
1089742143 11:120591856-120591878 GATGCAAATACAGAAGAGGAGGG - Intronic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1089750906 11:120650445-120650467 GAGAAAACAACACATGAGGAGGG - Intronic
1089768284 11:120784419-120784441 GAGAAAATGACAGATTAGAATGG - Intronic
1089881609 11:121779281-121779303 GAGGAAAATACATATGAGTCTGG + Intergenic
1089894496 11:121915822-121915844 GAGGAAAAGAGAGAAGAAGAAGG - Intergenic
1090054429 11:123410317-123410339 GAGAAAGAAACAGAGGAGGAAGG + Intergenic
1090083906 11:123634079-123634101 GAGGGGAAGGCAGATGTGGATGG - Intronic
1090098498 11:123768616-123768638 GAGGAAGAGAGAGATGGGGGAGG - Intergenic
1090402428 11:126457821-126457843 GAGGAAAAGAGATATGAAGGAGG + Intronic
1090440209 11:126719038-126719060 GAGGAAAACAAACATGAGAAAGG - Intronic
1090484969 11:127105111-127105133 GAGAAAGAAACAGAAGAGGAAGG - Intergenic
1090493307 11:127185404-127185426 GAGTAGAAGACAGAGGAAGAAGG - Intergenic
1090607695 11:128439079-128439101 GAGTAAAAGTCAGAGGATGAAGG + Intergenic
1090620604 11:128557649-128557671 GAAAAAAAGAAAGTTGAGGATGG - Intronic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090746288 11:129707730-129707752 GCGGAAAAGTGGGATGAGGAAGG + Intergenic
1090862442 11:130666106-130666128 GAGGAAAAGGAAGACGAGGAGGG - Intergenic
1090923860 11:131232562-131232584 GAGAAAAAGAGAGGAGAGGAGGG - Intergenic
1090938957 11:131371213-131371235 GGGGAAATGACAGATTCGGAGGG + Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091573465 12:1711700-1711722 GAGGAAGAGACAGACAAAGAGGG - Intronic
1091819066 12:3460912-3460934 GAAGAGAAGACAGAAGAGGAGGG + Intronic
1091842068 12:3628398-3628420 GAGGAAAGGACAGAACAGAAGGG + Intronic
1092017199 12:5169312-5169334 GAAGAACAGCCAGATGGGGAAGG - Intergenic
1092088278 12:5783763-5783785 AAGGAAACCTCAGATGAGGAAGG - Intronic
1092168856 12:6360737-6360759 GAGGAGAAGGCAGGGGAGGAGGG + Intronic
1092217236 12:6692106-6692128 GCAGGAAAGACAGAGGAGGAAGG - Intergenic
1092219240 12:6701304-6701326 GAGGAAAGGACTGGGGAGGAAGG + Intergenic
1092656571 12:10691200-10691222 GAGCAAAAGGCAGATGAAGGAGG - Intergenic
1092674152 12:10897698-10897720 GAGGAAGAGAAAGATGGGGGAGG + Intronic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1093236255 12:16611132-16611154 GAGGGAAAGAGAGATGGGGGAGG + Intergenic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093795126 12:23301975-23301997 GAGGAAAAGAATGAAGAGGGAGG - Intergenic
1093910473 12:24741682-24741704 GTGGAAAAGCCAGATGAGATGGG - Intergenic
1093971230 12:25377900-25377922 GAAGCATAGACAAATGAGGAGGG - Intergenic
1093993062 12:25611423-25611445 GAGGAATACAGTGATGAGGAGGG + Intronic
1094619254 12:32064580-32064602 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1094730084 12:33164323-33164345 GAGGAAAAGACAGCTCAAAAAGG + Intergenic
1094743924 12:33321015-33321037 GAGGAAAAGGCAGATCATGTAGG - Intergenic
1094831866 12:34303990-34304012 GAGGTACAGACACATGTGGAAGG + Intergenic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095267372 12:40175889-40175911 GAGGAAAAGTCAGATTCAGAAGG + Intergenic
1095372578 12:41486827-41486849 GAGGAAGAGAGAGCAGAGGAGGG - Intronic
1096111072 12:49029495-49029517 GAAGAAAAGTCAGGTGAGGGTGG + Intronic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1096387269 12:51203219-51203241 GAGGAAATGAGATATGAAGATGG + Intronic
1096429875 12:51534243-51534265 GAGGAAGAGGAAGAGGAGGAAGG - Intergenic
1096849466 12:54426487-54426509 GAGGAAAAGACAGAGGGGCAAGG + Intergenic
1097145999 12:56939692-56939714 GGGGAAAGGACAGAAGAGAAAGG + Intergenic
1097369171 12:58755395-58755417 GAGGAAGAGAGAGATGGAGAGGG + Intronic
1097392500 12:59032819-59032841 GTGGAAAAGATAGGAGAGGAGGG + Intergenic
1097402794 12:59150115-59150137 GAGGAAATGGCAGATGCGAATGG + Intergenic
1097591877 12:61584660-61584682 TAGGAACAGACAGATAAGGAGGG - Intergenic
1097938394 12:65278535-65278557 GAGGACAGGGCAGAGGAGGAGGG + Intergenic
1098016324 12:66108505-66108527 GAGGAAAAGACAGATAGGGAAGG - Intergenic
1098135790 12:67400435-67400457 GACAAAAAGACAGATGATGGGGG - Intergenic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098334658 12:69390802-69390824 GAGGAAGAAACACATCAGGAGGG - Intergenic
1098356950 12:69621049-69621071 CAAGAAAAGAGAGGTGAGGAAGG + Intergenic
1098378065 12:69838329-69838351 GAGGAGGAGGCAGAGGAGGAAGG - Intronic
1099099683 12:78423160-78423182 GAGGAAGAGAGAGCAGAGGAAGG - Intergenic
1099109778 12:78543988-78544010 GAGGAAAATGAAGAAGAGGAAGG + Intergenic
1099142629 12:78997745-78997767 GAAGAAGAGACACATGGGGAAGG + Intronic
1099153394 12:79144087-79144109 GAGGAAATGACAGATCAAGGAGG - Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099218499 12:79882734-79882756 GAGGAAGAGTCAGTTGATGAGGG + Intronic
1099252492 12:80273441-80273463 GAGGAAAAGTCAGATGGAAATGG + Intronic
1099425994 12:82523133-82523155 GGGTAAAAGACAGCTGGGGATGG + Intergenic
1099576659 12:84391780-84391802 GAGGAAGAGACAGACAAAGAAGG - Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099734753 12:86552351-86552373 GAGGATAATACAGGTTAGGAAGG + Intronic
1099986732 12:89674374-89674396 AAGGAAAGGAAAGATAAGGATGG + Intronic
1100153613 12:91771622-91771644 GAGGAAATGAAAGATAAGGGTGG + Intergenic
1100291516 12:93219170-93219192 GAGTAAAAGAAAGAGCAGGAGGG + Intergenic
1100415965 12:94375227-94375249 GAGAGAAAGACAGAGGAAGAAGG + Intronic
1100569898 12:95837579-95837601 GAGGGAGAGAGAGATGAGGGAGG + Intergenic
1100692721 12:97056116-97056138 GAGGAAGAGAGAGATGGGGGCGG + Intergenic
1100758429 12:97777924-97777946 GAGGAAAAGAAAGAAGAAAATGG - Intergenic
1100773686 12:97951415-97951437 GAAGAAGAGACAGATAGGGAAGG + Intergenic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101316236 12:103631847-103631869 GAGAAAAGGAAAGAAGAGGAGGG + Intronic
1101363777 12:104052716-104052738 GGGGTAAAGAGAGAAGAGGAGGG - Intronic
1101406802 12:104435930-104435952 GGGGAAGAGAAAGATCAGGAAGG - Intergenic
1101531867 12:105580740-105580762 GAGGAAGAGAGAGAGGAGCATGG - Intergenic
1101578770 12:106022721-106022743 GGAGAAAAGAGAGATGAAGAGGG + Intergenic
1101646966 12:106640311-106640333 AAGGAAAAGAAACATCAGGAAGG + Intronic
1101648624 12:106654358-106654380 GAGGACAAGCCTGATGAGGCTGG - Intronic
1101655561 12:106717078-106717100 CAGGAAAAAGCAGAAGAGGAAGG - Intronic
1101922450 12:108943852-108943874 GAGGAAGAGGAAGAAGAGGAAGG - Intronic
1102567612 12:113807212-113807234 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1102710439 12:114921516-114921538 GAAAGCAAGACAGATGAGGAGGG - Intergenic
1102746228 12:115251332-115251354 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1102746242 12:115251426-115251448 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1102746257 12:115251520-115251542 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103080936 12:118023457-118023479 GAGGAGAAGGCGGAGGAGGAGGG + Intronic
1103222476 12:119257362-119257384 CAGGAAAAGAAAGAAAAGGAGGG + Intergenic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104386297 12:128354472-128354494 AAGGAAAAGACAGAAAAGGAAGG - Intronic
1104425636 12:128675195-128675217 AAGGAAAAAGCAGATGAAGAAGG + Intronic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104533241 12:129592972-129592994 GAGGAAGAGACACAGGAGGGTGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104731729 12:131108919-131108941 CAGGAAGAGACAGGTGGGGATGG + Intronic
1105269088 13:18854175-18854197 AAGAGAAAGAAAGATGAGGAGGG - Intergenic
1106163158 13:27218299-27218321 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1106253352 13:28000969-28000991 GAGGAAGAGTTAGGTGAGGAAGG + Intergenic
1106407695 13:29488100-29488122 GAGGGAAAGACAGGAAAGGAGGG - Intronic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1106947044 13:34840213-34840235 GAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1106947064 13:34840311-34840333 GAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1107084655 13:36413490-36413512 GAGAAAAAGCCATGTGAGGACGG + Intergenic
1107475440 13:40731273-40731295 CAAGAAAAGACAGAGGAGGCCGG + Intronic
1108427621 13:50319657-50319679 GAGGAAAAGTCAAAGGGGGATGG + Intronic
1108516152 13:51204744-51204766 GAGCTAAAGAGAGATGGGGAGGG - Intergenic
1108571351 13:51754957-51754979 GGGGAAATGAGAGATGAGGCTGG - Intronic
1108711287 13:53035002-53035024 AAGGAAAAGAGAGATTAGAAGGG - Intronic
1108865651 13:54919518-54919540 CAGGAAAAGAAAGATCTGGAGGG + Intergenic
1109276644 13:60311263-60311285 GACAAAAAGACCAATGAGGAGGG + Intergenic
1109295838 13:60529822-60529844 GAAGGAAAGACAGAAGATGAGGG + Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110241693 13:73274645-73274667 AAGGAAAAGAGAGAAAAGGAAGG + Intergenic
1110261380 13:73489034-73489056 TAGGAAAAGACAGATTACAAAGG + Intergenic
1110423962 13:75344293-75344315 GAGGAAAAGAAAAATAAAGAAGG + Intronic
1110736270 13:78940670-78940692 GATGAAAAGGCAGTGGAGGAGGG + Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111442270 13:88295185-88295207 GAGAAACAGACAGAAGGGGAAGG - Intergenic
1111840824 13:93449170-93449192 GATAAAAGTACAGATGAGGAAGG + Intronic
1112238408 13:97657224-97657246 GAGGAAAAGAGAGAGGGAGAAGG - Intergenic
1112640328 13:101266969-101266991 CAGGAACAGACAGATGGGAAAGG - Intronic
1112778239 13:102868573-102868595 GGGGAAAGGAGAGATGAGTAAGG + Intronic
1112810255 13:103210027-103210049 GTGGCAAAGAAAGATGAAGATGG + Intergenic
1112839128 13:103553724-103553746 GAGGAGGAGAAAGAAGAGGAGGG - Intergenic
1112908071 13:104448227-104448249 GGGGTACAGACAGATGAAGATGG + Intergenic
1113203216 13:107889237-107889259 GAGGAAGAGAGAGAAGAGGGAGG + Intergenic
1113287204 13:108863979-108864001 GATGTAAAAACAGATGAAGATGG - Intronic
1113900203 13:113792625-113792647 GAGGAACAGACAGATGAGGGAGG - Intronic
1114133820 14:19823843-19823865 GAGAAAAAGAAAAATAAGGAAGG + Intronic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115113207 14:29849216-29849238 GAGGAAAAGAAAGAGGAGGGAGG - Intronic
1115285144 14:31707449-31707471 GAGGAAGAGACAGACAAAGAGGG - Intronic
1115788687 14:36855475-36855497 GAGGAAGCCACAGATGAGGAAGG - Intronic
1115999106 14:39224116-39224138 GAAGAGAAGAGAGAAGAGGAAGG - Intergenic
1116095549 14:40362419-40362441 GAGGAAGAGAAGGAAGAGGAGGG - Intergenic
1117005877 14:51420526-51420548 GAGGAACTCACAGATGTGGAGGG - Intergenic
1117512335 14:56465527-56465549 GAGGAAAAGATGGATGGGGTGGG + Intergenic
1117679170 14:58185593-58185615 GTGGGAAAGAAAGATGATGAAGG + Intronic
1118245733 14:64108718-64108740 GAGGGAAAGAAAGAAGAGAAAGG - Intronic
1118416671 14:65544949-65544971 GATGAAAAGAGAGAAGAAGAGGG - Intronic
1118535803 14:66763087-66763109 GAGGAACCCACAGATGTGGACGG - Intronic
1118570985 14:67195290-67195312 GAGGAAATGAGAGAAAAGGAAGG - Intronic
1118686180 14:68293472-68293494 AAGGAAATGACAGATTATGAAGG - Intronic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1118968938 14:70615323-70615345 GAAGAAAACAAAGATGAGAAAGG + Intergenic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119052471 14:71383684-71383706 GGGGGAAAGACAGAGGAGGGAGG + Intronic
1119918799 14:78427047-78427069 GAGGAAAAGACTGAGGGGGAAGG + Intronic
1119968855 14:78947141-78947163 GAGGATAAGACAGATTAGCCAGG + Intronic
1120074735 14:80142762-80142784 TAGGAATGGACAGATGATGAAGG - Intergenic
1120147690 14:80997357-80997379 GAGGTAAAGAGAGATAGGGAGGG - Intronic
1120316904 14:82905909-82905931 GTGGCAAAGGCAGATGAGGAAGG + Intergenic
1120382623 14:83800614-83800636 GAGGAGAGGACAGGAGAGGAGGG - Intergenic
1121222603 14:92297893-92297915 GAGGAAGAGAAAGAGGATGAGGG - Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121577528 14:95000500-95000522 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1121586959 14:95069118-95069140 GAGGAGAGGAGAGCTGAGGACGG + Intergenic
1121606458 14:95244018-95244040 GAGGAAAAGAGAGAGGGGGAAGG - Intronic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122589907 14:102841218-102841240 GAGGAAAACATAGGAGAGGAGGG + Intronic
1123056337 14:105572338-105572360 GCGGACCAGACAGATGGGGATGG + Intergenic
1123057594 14:105579469-105579491 GCGGACCAGACAGATGGGGATGG - Intergenic
1123080770 14:105692466-105692488 GGGGACCAGACAGATGGGGATGG + Intergenic
1123081871 14:105699402-105699424 GGGGACCAGACAGATGGGGATGG - Intergenic
1123404493 15:20011832-20011854 GAGGAAGAGGCAGATGAGCTGGG + Intergenic
1123513826 15:21018479-21018501 GAGGAAGAGGCAGATGAGCTGGG + Intergenic
1123576891 15:21679430-21679452 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123613513 15:22121898-22121920 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123773166 15:23549431-23549453 AAGAAAAAAATAGATGAGGAAGG + Intergenic
1123902679 15:24892391-24892413 GAGGAACAGAAAGAGGGGGAAGG + Intronic
1123958615 15:25368867-25368889 GAGCGAAAGACAGATAAGGAAGG + Intronic
1124353719 15:28979200-28979222 GAGCCACAGATAGATGAGGAGGG - Intronic
1125181410 15:36884045-36884067 GATGAAAAGAAAGAGGTGGATGG - Intergenic
1125353785 15:38794916-38794938 GAAGAAAAGAGAGAGGTGGAAGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125641504 15:41234352-41234374 GAAGAAAAGGCAGATGAAAATGG - Intronic
1125718633 15:41834579-41834601 CAGTAATAGAAAGATGAGGACGG - Intronic
1125800087 15:42438084-42438106 CCGGATAAGACAGATGAGAAAGG + Intronic
1126434237 15:48619469-48619491 TAGGAAAGGGGAGATGAGGAAGG - Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127025533 15:54801157-54801179 GAGCAAAAGAGAGAGGAGGGAGG + Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1127382470 15:58441899-58441921 GATGCAAACACAGATGTGGAGGG + Intronic
1127443252 15:59033296-59033318 GAGAAAAATACAGATGAAAAAGG - Intronic
1127578372 15:60314353-60314375 GAGGAAAAGAGAGATGGGAGAGG + Intergenic
1127884928 15:63190133-63190155 GATTAAAAGACAGGAGAGGAAGG + Intronic
1127948328 15:63778239-63778261 GCAGAAAAGACAGAGGAGAAAGG + Intronic
1128288187 15:66456070-66456092 GGGGAAAAGACTGAGGAGGTAGG - Intronic
1128293053 15:66493741-66493763 GAGGAAAAGATACAACAGGATGG - Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128999006 15:72317895-72317917 GAAGAAAAGACAGAGAAGCATGG + Intronic
1129208335 15:74050794-74050816 GATGAAAAGGCAGGGGAGGAAGG - Intergenic
1129787382 15:78318820-78318842 CAGGAGAAGGCAGTTGAGGAGGG + Intergenic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130226011 15:82058880-82058902 GAGGAAGAGAGAGGAGAGGAAGG - Intergenic
1130543277 15:84837286-84837308 GAGGAAAAGTCTGATGATGCAGG + Intronic
1130696107 15:86133168-86133190 GAGAGAAAGACAGAAGAGAAGGG - Intergenic
1131014148 15:89043496-89043518 GAGGAAAAGAAAGAGGAAGGAGG + Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131597865 15:93816792-93816814 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1132023707 15:98386510-98386532 GAGGAGAGGGCAGAGGAGGAAGG - Intergenic
1132240477 15:100253553-100253575 GAGGGAAAGGGAGAGGAGGAGGG + Intronic
1202985759 15_KI270727v1_random:413675-413697 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1132584914 16:701915-701937 GAGGACAAGACAGCTGAGGTGGG - Intronic
1133246190 16:4450443-4450465 GAGGACGAGACAGATGTGGAGGG + Exonic
1133505100 16:6403916-6403938 GAGGAAGAGACACAGTAGGAAGG + Intronic
1133599208 16:7322839-7322861 GAGGAGAAAACAGAAGGGGAAGG - Intronic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1133766178 16:8839556-8839578 GAGGAAGAGTCTGATGAGCAAGG + Intronic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134316956 16:13127402-13127424 GAGAAGGAGACAGAGGAGGAGGG + Intronic
1134329004 16:13233292-13233314 GAGGAAGAGAGAGAGGAAGAAGG + Intronic
1134449297 16:14353960-14353982 GAGGCAAAGAAAGGGGAGGAGGG + Intergenic
1134449307 16:14353984-14354006 GAGGGAAAGAAAGGGGAGGAGGG + Intergenic
1134562875 16:15225900-15225922 AAGGAAGAGAGAGAAGAGGAAGG + Intergenic
1134613717 16:15632438-15632460 GCAGAAAAGAGAGATAAGGAAGG + Intronic
1134771332 16:16812149-16812171 GAGGAAGAGAGAGAGGAGGAGGG + Intergenic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1134892568 16:17853997-17854019 GAGGAAAAGAGAGGAGGGGAGGG + Intergenic
1134923412 16:18137533-18137555 AAGGAAGAGAGAGAAGAGGAAGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135414287 16:22257119-22257141 GAGGAAAAGACAAAGGAAAAAGG - Intronic
1135606789 16:23832666-23832688 GATATAAAGACAGAGGAGGATGG + Intergenic
1135725467 16:24850684-24850706 GAGGAAAACAAAGCTGAGGCCGG - Intronic
1137272620 16:46912299-46912321 GAGGAAGGTACAGCTGAGGAGGG - Intronic
1137292650 16:47062309-47062331 GACTAAAAGACAGAGAAGGAAGG + Intergenic
1137404530 16:48179206-48179228 GCAGAAAAGTGAGATGAGGAAGG - Intronic
1137812135 16:51362880-51362902 GAGGAACAGAAAGATTTGGAGGG + Intergenic
1137842208 16:51651084-51651106 GAGGAACAGACTGATTCGGAGGG - Intergenic
1138158760 16:54732540-54732562 GAGGGAGAGAAAGAAGAGGAGGG + Intergenic
1138173784 16:54877433-54877455 GAGGAAGAGAGAGAAGGGGAAGG + Intergenic
1139131201 16:64148282-64148304 GAAGAAAAGAAAGAGAAGGAAGG - Intergenic
1139972646 16:70785884-70785906 GAGGAGAAGACAGATCAGAATGG + Intronic
1140240222 16:73193356-73193378 GAGGAAAGGAGAGATGGGGGCGG + Intergenic
1140310034 16:73840244-73840266 GAGGAAAAGAAAGAGGGGGCAGG + Intergenic
1140489380 16:75321619-75321641 GCGGAAAAGAGGGGTGAGGAAGG + Intronic
1140491229 16:75337672-75337694 GAGGAAGAGACAGAAGTGGGAGG + Intronic
1140597208 16:76430662-76430684 GAGGCACAGACAGGGGAGGATGG - Intronic
1140603944 16:76511911-76511933 GAGGAAAATAAAGTTGAGGCAGG + Intronic
1140712379 16:77690528-77690550 GAGGAAGAGACAGCAGAGGGAGG + Intergenic
1141157750 16:81609210-81609232 GAGAGAAAGAAAGAAGAGGAAGG - Intronic
1141346186 16:83248214-83248236 GATGAAAAAAGAGATCAGGAAGG + Intronic
1141475826 16:84272668-84272690 GAAGGAAAGATAGATGATGAGGG - Intergenic
1141496256 16:84411965-84411987 AAGGAAAAGAAAGAAGAGAAAGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141856384 16:86683868-86683890 GAGGCAAAGAGAGATGTGGAGGG - Intergenic
1141856397 16:86684017-86684039 GAGAAACAGAGAGATGTGGAGGG - Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142536973 17:624968-624990 GAGAGAAAGACAGAGAAGGAAGG - Intronic
1142835205 17:2580433-2580455 GAAGAAAAGGCAGTGGAGGAGGG + Intergenic
1143046632 17:4086197-4086219 GAAGAGAAGTCAGCTGAGGAAGG + Intronic
1143108101 17:4539429-4539451 GAAGAAAGCACAGGTGAGGAAGG - Exonic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143405287 17:6673521-6673543 GAGGAAAAGGGACATGACGAGGG + Intergenic
1143592822 17:7895783-7895805 TGGAAAAAGACAGATAAGGAAGG - Intronic
1143916118 17:10294707-10294729 GAGGAAAAGAGAGAAGTGGGAGG + Intergenic
1143965763 17:10755667-10755689 GAGAAAGAGACAGAGGAGGAGGG - Intergenic
1144045703 17:11452792-11452814 GAGGAAAAAAGAGAGGATGAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144531670 17:16045061-16045083 GAGGAAAAGACTGATAAGACTGG + Intronic
1145110203 17:20155860-20155882 GAAGGAAATACAGATGAGGTGGG + Intronic
1145747600 17:27331992-27332014 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1145902257 17:28496622-28496644 GATGAAAAGTCAGAGCAGGAAGG - Intronic
1146082603 17:29795095-29795117 GATGTAAAGGTAGATGAGGATGG - Intronic
1146490618 17:33278893-33278915 AAGGAGATGACAGCTGAGGAAGG + Intronic
1146839892 17:36143979-36144001 GAGGAAGAAAGAGATGAGGAGGG + Intergenic
1146958589 17:36952888-36952910 GAGGAAATATCTGATGAGGAAGG + Exonic
1147229136 17:39004384-39004406 GAGAGAAAGACAGAAAAGGAAGG - Intergenic
1147497079 17:40926898-40926920 GAAGAAAGGAGAGAAGAGGAGGG - Intronic
1147521012 17:41173498-41173520 GAGGAAGAGGAAGAGGAGGAGGG - Intergenic
1148401413 17:47365007-47365029 GAGGAAAAGACAGTTGAGTTTGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148581490 17:48747125-48747147 GGGGAACAGGCAGATAAGGATGG - Intergenic
1148617939 17:49014250-49014272 GAGGGGGAGACAGATGGGGACGG - Intronic
1148963520 17:51413812-51413834 GAGTTAAACACAGATCAGGAAGG + Intergenic
1149053279 17:52332345-52332367 GAGCAAAAGAAAGATGTGAAAGG - Intergenic
1149201180 17:54187783-54187805 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1149335119 17:55627505-55627527 GAGGAAAAGTCAGAAGATGTGGG + Intergenic
1149373066 17:56014902-56014924 GAGGAAAAGGAAGAAGGGGAAGG - Intergenic
1149501202 17:57153752-57153774 GAGAAAGAGACAGAGGAGGAGGG - Intergenic
1149783344 17:59415549-59415571 GAGGAAGAAACAGATAAGGAAGG + Intergenic
1149983583 17:61330656-61330678 GAGGAATAGCCAGATGGGCAGGG - Intronic
1150152235 17:62819559-62819581 GGGGAAAGGAGAGAAGAGGAAGG - Intergenic
1150272382 17:63874772-63874794 GAGGAAGAGACAAAAGAGGACGG - Intronic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1150275901 17:63897447-63897469 GAGGAAGAGACAAAAGAGGACGG - Intergenic
1150281555 17:63932088-63932110 GAGTGAGAGACAGAGGAGGAGGG + Intronic
1150455479 17:65303722-65303744 GAGGGAAAGAAAGATGGAGAGGG + Intergenic
1150463187 17:65370272-65370294 GAGGAAAAGACACAGAGGGAGGG - Intergenic
1150465181 17:65386578-65386600 GAGGAATAGGCAGAGAAGGACGG - Intergenic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150664185 17:67115584-67115606 CAGAAAAACACAGATAAGGATGG + Intronic
1150697700 17:67419967-67419989 GATGGATAGACAGATGTGGATGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151102426 17:71571411-71571433 GAGCAAGAGAGAGAGGAGGAGGG - Intergenic
1151191752 17:72403751-72403773 GAAGCAAAGAAAGTTGAGGATGG + Intergenic
1151308988 17:73282068-73282090 GAGGACCAGGCAGATGAGAAGGG - Intergenic
1151432730 17:74075161-74075183 GAGGAAGAGAGAGAAGAGGGAGG + Intergenic
1151775589 17:76199243-76199265 GAGGAAGAGAAAGTAGAGGAAGG - Intronic
1152084064 17:78206659-78206681 GAGGAGAAGAAAGAAGATGAAGG - Intronic
1152106463 17:78332256-78332278 GATGACAACACAGAGGAGGAAGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152400753 17:80065013-80065035 GAGGAAGAGGGAGAGGAGGAGGG - Intronic
1152444758 17:80335323-80335345 GAGGAAGAGGCAGAGGAGGCAGG + Intronic
1152453505 17:80398685-80398707 GAGGAAGAGACAGACAAAGAGGG + Exonic
1152881970 17:82822873-82822895 GAGGGAGTGAGAGATGAGGAAGG + Intronic
1152988157 18:338110-338132 GTGGAAAATACAGAGGAGGATGG - Intronic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153578653 18:6549399-6549421 GAGGAAAAGAGAGAAGGGGAAGG + Intronic
1153615770 18:6931599-6931621 GATGGAAAGAGAGAAGAGGAGGG - Intergenic
1153633121 18:7090697-7090719 GAGAAAAAGAGAGAGAAGGAAGG + Intronic
1154144118 18:11851971-11851993 CAGGAAATGGCAGATGAGGCGGG + Exonic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155304372 18:24464696-24464718 GATGAACAAATAGATGAGGATGG - Intronic
1155453651 18:25988488-25988510 CAGGAATGGACACATGAGGAGGG - Intergenic
1155839134 18:30625982-30626004 GAGGAAATGACAGAAGCAGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155868757 18:30998974-30998996 AAGAAAAAGAGAGATGTGGAGGG + Intronic
1156097817 18:33557125-33557147 GAGGAAAAGAAAGAAAAAGATGG + Intergenic
1156504574 18:37581198-37581220 GAGCAAAAGAAAGAGGAAGAGGG - Intergenic
1156681759 18:39598375-39598397 GAGGAAGAGGAAGAAGAGGAGGG - Intergenic
1156825514 18:41426241-41426263 AAGTGAAAGAGAGATGAGGATGG - Intergenic
1157282899 18:46357883-46357905 GAAGAGAGGAGAGATGAGGAAGG - Intronic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157655443 18:49383114-49383136 AAGAAAAAGACAGATGAAAAGGG + Intronic
1157673134 18:49547587-49547609 GAGGTAAAGTATGATGAGGAAGG + Intergenic
1157763835 18:50283173-50283195 AAGGAAAAGTGAGGTGAGGAAGG + Intronic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1157964726 18:52194908-52194930 GAGGAAGAAAGAGATGAGGCAGG - Intergenic
1157989665 18:52479522-52479544 GAGAGAGAGAGAGATGAGGAGGG - Intronic
1158089910 18:53698748-53698770 GAGGAAGAGAGAGAAGGGGAAGG + Intergenic
1158370755 18:56800807-56800829 AGGGAAAATACAGATGAGCAGGG - Intronic
1158473080 18:57755865-57755887 CAGGGACAGACAGATGAAGAGGG + Intronic
1158521669 18:58176316-58176338 GAGGAAGAAAGAGATGAGGGGGG - Intronic
1158529002 18:58241340-58241362 GGAGAAAAGACAGATGGAGAGGG - Intronic
1158713738 18:59859866-59859888 GGAGAAAAGCCACATGAGGAAGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159480260 18:68981025-68981047 GAGGAAATGACTGCTGTGGAAGG + Intronic
1159599060 18:70411346-70411368 GAGGAAAGGCCCTATGAGGACGG + Intergenic
1159682888 18:71377070-71377092 GAAGAAAAGACAGGTGGGAAAGG - Intergenic
1159759675 18:72408846-72408868 GAGGAAGAAAGAGATGGGGAAGG - Intergenic
1159786604 18:72722232-72722254 GAGGAAAAGTCAGTGGAGGGGGG - Intergenic
1159818074 18:73102288-73102310 GAAGAAAAGTCAGCTGAGAATGG + Intergenic
1160371595 18:78376737-78376759 GAAGAGAAGGCACATGAGGAAGG - Intergenic
1161287215 19:3474919-3474941 GAGAAAAAGACAGCAAAGGAAGG - Exonic
1161796798 19:6391752-6391774 GAAGAAAAGATAGATGACAAAGG - Intronic
1161830394 19:6598542-6598564 GAGGAAGAGACAGACAAAGAGGG + Intronic
1161836284 19:6649305-6649327 GTGGAGGAGACAGAAGAGGAAGG - Intergenic
1161849045 19:6729577-6729599 GAGGAAAAGAAAGAATAGGCTGG - Intronic
1162038201 19:7953620-7953642 GAGGAAGAGGAAGAGGAGGATGG - Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162204675 19:9046886-9046908 GAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1162281767 19:9703766-9703788 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1162339204 19:10081729-10081751 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1162346068 19:10118881-10118903 GAGTACAAGATAGATGAGGATGG - Exonic
1162492070 19:10998816-10998838 GAAGAAAAGTCTGATGAGGAAGG - Intronic
1162809088 19:13153616-13153638 GAAGAAAAGGAAGAAGAGGAGGG + Exonic
1162901101 19:13795847-13795869 GAGGAGAAGACAGGTGGGGAAGG - Intronic
1163991612 19:21003728-21003750 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1164324601 19:24180503-24180525 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1164386771 19:27778022-27778044 CAGCAAAAAACAGATGAAGAAGG - Intergenic
1164896102 19:31879032-31879054 GAGGAAGAGAGAGAGGAGGCAGG + Intergenic
1165127650 19:33611755-33611777 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165799052 19:38536513-38536535 GAGGGAATGAAAGAAGAGGATGG - Intronic
1166309083 19:41952222-41952244 GAGGAAAGGAAAGGAGAGGAAGG - Intergenic
1166423145 19:42653703-42653725 AGGGAAGAGACAGATGGGGATGG + Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1167191259 19:47991643-47991665 GAGGAGCAGACGGAGGAGGAGGG - Intronic
1167334456 19:48875851-48875873 GACGAAGGGACAGAGGAGGAAGG - Exonic
1167584063 19:50363285-50363307 GAGAAAAAGAGAGATGGGGGCGG + Intronic
1167587862 19:50384996-50385018 GAGAGAAACACAGATGAGGTCGG + Intronic
1167686957 19:50962497-50962519 TAGGAAAGGACCAATGAGGAAGG - Intronic
1168076983 19:53985986-53986008 GAGGAAGAGCAAGATGGGGAGGG + Exonic
1168185958 19:54699425-54699447 GAGGAGGAGGCAGAGGAGGAGGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168650145 19:58087335-58087357 GAAGCAAAGACCGAAGAGGACGG - Exonic
1168663447 19:58184664-58184686 GTAGAAAAGACAGGTGAGGATGG + Intronic
924958863 2:15724-15746 GAGGAAATAATAGATGAGGCTGG - Intergenic
924979120 2:204312-204334 GAGGAAGAGATAGAAGGGGAAGG - Intergenic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
925237909 2:2295224-2295246 TGGGAAGAGACAGATGAGGAAGG + Intronic
925496202 2:4452379-4452401 GAAGAAGAGAAAGAAGAGGAAGG - Intergenic
925571679 2:5318981-5319003 GATGGAAAGAAAGATGAGGGAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925744549 2:7033176-7033198 GAGCAAAATACATGTGAGGATGG - Intronic
926292034 2:11538977-11538999 GAGGAGAAGAGAGGAGAGGAGGG - Intronic
926454835 2:13054417-13054439 GAGGAAGAGACAGAGGGGGTAGG - Intergenic
926491618 2:13532047-13532069 GAGGAAGAGACAGACAAAGAGGG - Intergenic
926848983 2:17173975-17173997 GAGGGAAAGAAAGAGGGGGAAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926887212 2:17609254-17609276 AAGGAGAAGACAGAGGAGTAGGG + Intronic
927144164 2:20150476-20150498 CAGGAATCCACAGATGAGGAAGG + Intergenic
927366025 2:22297323-22297345 GAGGATAAGATAGGTTAGGAGGG + Intergenic
927562734 2:24084897-24084919 GAGGAAAGGAAAGAGGGGGAGGG - Exonic
927661898 2:25000590-25000612 GAGGAAAACAAAGATGAAGAGGG - Intergenic
927826087 2:26311175-26311197 GAGGAAATGACAGAGGAAGGCGG + Exonic
927894738 2:26774445-26774467 GAGGGAAAGAGAGAAGTGGATGG - Intronic
927981961 2:27380140-27380162 GAGGAAGAGGAAGAGGAGGAAGG - Exonic
928133857 2:28673441-28673463 GAGAAAGAGAAAGAAGAGGAGGG + Intergenic
928216111 2:29362708-29362730 GTGGATAAGACAGATAAAGAAGG - Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928592796 2:32834631-32834653 GGAGAAAAGACAGATGGGGAGGG - Intergenic
928771352 2:34705540-34705562 GAGGAAGAGAAGGAGGAGGAAGG - Intergenic
929018204 2:37523353-37523375 GAGGCACAGAGAGATGATGATGG + Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929592165 2:43154428-43154450 GATCAAAAGGCAGAGGAGGATGG + Intergenic
929606261 2:43236250-43236272 AAGGCAAGGACAGAAGAGGAAGG + Intronic
929882513 2:45849411-45849433 GAGGAAGAGAATGCTGAGGATGG - Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930345184 2:50171121-50171143 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
930424990 2:51201748-51201770 GAGAAAAAGACATAAGAGGGAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930710228 2:54543812-54543834 GAGGAAGAGACAGATGGGAGTGG + Intronic
931540769 2:63326757-63326779 GAGGAAGAGACAGACAAAGAGGG + Intronic
931810003 2:65845546-65845568 GGGGAGTAGACAGGTGAGGAGGG - Intergenic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
932232028 2:70090727-70090749 GAGGCCAAGACAGGTGGGGAGGG + Intergenic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932879649 2:75489280-75489302 GAGGAAGAGAGAGAAGAGGTGGG + Intronic
932974872 2:76586893-76586915 GAGGAAACCAGAGCTGAGGAAGG + Intergenic
933262182 2:80142934-80142956 GTGGAAAAGAGAGATGAAAAGGG + Intronic
933599769 2:84317524-84317546 AGAGAAAAGACAGCTGAGGAGGG - Intergenic
933841861 2:86293357-86293379 GAAGGAAAGACAAATGATGATGG + Intronic
933985959 2:87592361-87592383 GAGGAAGAGAGAGAGGGGGAAGG - Intergenic
934524292 2:95042120-95042142 GAGGAGAAGAGAGGAGAGGAGGG + Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935140615 2:100349990-100350012 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935469801 2:103444554-103444576 GAAGAGCAGACAGATGACGAGGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935817862 2:106864069-106864091 GAGTAAAAGCCAGAGGAGGCTGG + Intronic
936094132 2:109518882-109518904 GAGGAAGAGAGAGGTGGGGAAGG + Intergenic
936307878 2:111358443-111358465 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
936379554 2:111972338-111972360 GAGGACATGAAACATGAGGATGG + Intronic
936501659 2:113071725-113071747 GAGGAATAGAGAGATGCTGAGGG - Intronic
936627188 2:114161029-114161051 GAGGGAAAGAGAGAGAAGGAGGG - Intergenic
936654480 2:114468961-114468983 AAGGAAAAGACAAATGAAAATGG + Intronic
937009958 2:118553596-118553618 AAGGAAAGGAAAGAAGAGGAAGG + Intergenic
937070773 2:119061360-119061382 AAGGAAAAGAAAGATGAAAAGGG - Intergenic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
937412309 2:121687214-121687236 AAAGAAAAGAAAGGTGAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
938577081 2:132614947-132614969 GAAGAAAAGACAGACAAAGAAGG - Intronic
939094721 2:137821518-137821540 GGGGAACAGGCAGATGGGGATGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939831618 2:147079503-147079525 GAGGAGGAGGCAGAAGAGGAGGG + Intergenic
940007145 2:149018357-149018379 GAGGACAACACAGATGAGCACGG - Intronic
940216118 2:151305314-151305336 GATGAAAAGAGAGGAGAGGAAGG + Intergenic
940554213 2:155202565-155202587 GAGGTAAAGACAGTTGACAACGG + Intergenic
940703966 2:157080842-157080864 GAGGTAAAGAGAAATGAGGCTGG + Intergenic
940809803 2:158229735-158229757 GAGGAGGGGACAGATGAGGAGGG - Intronic
940840755 2:158578819-158578841 GAGGAAATGGCACAAGAGGAGGG + Intronic
940913545 2:159229861-159229883 GAGGAAGGGACAGATGAGGATGG - Exonic
940977040 2:159957796-159957818 GAGGAAAAGATAGAAGAGAAAGG + Intronic
941243717 2:163071432-163071454 GAGGAAGAGACAGACAAAGAGGG + Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941412210 2:165172999-165173021 GAGAAAATGACAGATGAATAGGG + Intronic
942116556 2:172735116-172735138 GAAGAAAACACAGTTGAGAATGG - Intergenic
942296625 2:174523816-174523838 AAGGAAAAAACAAATCAGGAAGG - Intergenic
942495944 2:176540185-176540207 CAGTAAAAGGCAGAAGAGGAGGG + Intergenic
942818484 2:180081332-180081354 GAGGAAAATACAGATGCAGGAGG - Intergenic
943102878 2:183509224-183509246 GAGGAAGAGACAGACAAAGAAGG - Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943688648 2:190845781-190845803 GAGTAAATGACAGGTGAGCAAGG - Intergenic
943770143 2:191707413-191707435 GGGCAAAAGACAGATGAAGCAGG - Intergenic
943902203 2:193454898-193454920 GAGGAAGAGACAGACAAAGAGGG + Intergenic
944958717 2:204843382-204843404 GAGGAGAGGAGAGAAGAGGAAGG - Intronic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945206267 2:207335431-207335453 GAAGAAAAGACAGTAGAGGAAGG - Intergenic
945509758 2:210686641-210686663 GAGGGAAGGACAAATCAGGAAGG + Intergenic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946201545 2:218073476-218073498 GAGGCAGAGACAGATGGGGCTGG - Intronic
946322191 2:218960602-218960624 GAGGTAGAGGCAGGTGAGGAAGG - Exonic
946599900 2:221348365-221348387 GAGGAAGAGAAAGAGGGGGAAGG - Intergenic
946717076 2:222563921-222563943 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
946729276 2:222692724-222692746 GAGGACAAGAGAGATAAGGAAGG + Intronic
946808671 2:223498754-223498776 GAGGAAAATAGAGAGGAGGTAGG - Intergenic
946896957 2:224333726-224333748 GACTAAAAGACAGATGTGGAAGG - Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
947494709 2:230626381-230626403 GAGGAAAAGATAGAGGACTAAGG + Intergenic
947922224 2:233887142-233887164 GAAGAAAAGACAAAAGAGAAGGG + Intergenic
947962234 2:234248872-234248894 GAGGAAGAGAGCGAAGAGGAAGG - Intergenic
948253382 2:236549176-236549198 GAGGAGAAGACACAGGAAGAGGG - Intergenic
948281820 2:236752889-236752911 AAGGAGAAGACAGCAGAGGAGGG - Intergenic
948554563 2:238799005-238799027 AAGGAAAAGAAAGATAAGAAAGG + Intergenic
948603548 2:239120821-239120843 GAGGACAAGGCAGCTGAGGGTGG + Intronic
948615501 2:239196168-239196190 GAGGATGGGACAGAAGAGGAGGG + Intronic
948691221 2:239706340-239706362 GAGGGGGAGACAGAGGAGGAGGG - Intergenic
1169237314 20:3941300-3941322 GGGGAAAAGACATATAATGATGG + Intronic
1169388482 20:5170536-5170558 GGGGAAGACACAGAGGAGGAGGG - Intronic
1169659204 20:7959395-7959417 GAAGAAAATAAAGGTGAGGAGGG - Intergenic
1170007628 20:11686454-11686476 GAGGAAGTGAAAGAGGAGGACGG + Intergenic
1170155977 20:13269731-13269753 GAAGAAAAGAAAGAAGATGATGG - Intronic
1170370227 20:15640147-15640169 GAGAAAAAGAGATGTGAGGAAGG + Intronic
1170405640 20:16032814-16032836 GAGGAAAAAAGAGAGAAGGAAGG + Intronic
1170480992 20:16764665-16764687 GAGAGAAAGAAAGATGAAGAGGG - Intronic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1170879178 20:20279554-20279576 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
1171072924 20:22092640-22092662 CAGAAAAAGAGAGAAGAGGAAGG - Intergenic
1171243365 20:23588815-23588837 GAGGCAGAGACAGAGGATGAGGG - Intergenic
1171278801 20:23879845-23879867 GAGATAGAGACAGAAGAGGAGGG - Intergenic
1171416215 20:24982411-24982433 GTAGAAAAGCCTGATGAGGAAGG - Intronic
1171756226 20:29112529-29112551 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1171786017 20:29465305-29465327 GAGGAAGAGAGAGAGGGGGAAGG - Intergenic
1171862206 20:30411603-30411625 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1171907422 20:30911359-30911381 GAGAAAAAGACAGACAGGGAGGG - Intergenic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172988562 20:39014006-39014028 AAGGAAAAGACAGCTGAACAAGG - Intronic
1173027174 20:39319128-39319150 AAGGAAGAGACAGATGTGGAGGG - Intergenic
1173094004 20:40006768-40006790 GAGGAAAAGACAGAAGGGGGAGG - Intergenic
1173182016 20:40812985-40813007 GAGGAAAAGACAGAGAAAGTGGG + Intergenic
1173185038 20:40834065-40834087 GAGTAAAAGATAGATGAGTTTGG + Intergenic
1173299101 20:41784847-41784869 GAGACAGAGACATATGAGGAAGG + Intergenic
1173586771 20:44188127-44188149 GAGCAAAAGACAGCTCAGAAAGG - Intergenic
1173617681 20:44413664-44413686 GAGGCACAGAGAGGTGAGGAGGG - Intronic
1173744634 20:45426866-45426888 GAGGAAAAGACAGAAGATGAGGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174095113 20:48082631-48082653 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1174117084 20:48233828-48233850 GAGGAAAAGAGAGAGATGGAAGG + Intergenic
1174279592 20:49429483-49429505 GGGGAACATACAAATGAGGAAGG + Intronic
1174390075 20:50213590-50213612 GAGGAAAATAAAGAAGGGGAGGG + Intergenic
1174685995 20:52455695-52455717 GAGCAAAAGAGAGAAGAGGGAGG + Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1175244198 20:57571804-57571826 GTTGAAAAGAGAGCTGAGGAAGG + Intergenic
1175587861 20:60159811-60159833 GAGGCAAAGAAAGGTGAGGGAGG - Intergenic
1175657839 20:60787135-60787157 GAGAAGAGGACAGAGGAGGAGGG - Intergenic
1176389022 21:6154238-6154260 AAGGAAAGGACAGAGGAGGGTGG + Intergenic
1176854366 21:13953470-13953492 AAGAGAAAGAGAGATGAGGAGGG - Intergenic
1177478856 21:21660012-21660034 GAAGAGAAGACAGAAGAGTATGG - Intergenic
1177756598 21:25356147-25356169 CAAGAGAAGACAGAAGAGGAGGG + Intergenic
1178007911 21:28243663-28243685 GAGTAGAAAACAGAAGAGGATGG + Intergenic
1179095172 21:38307896-38307918 CAGAAAAAGAGAGATGAGGCTGG - Intergenic
1179208580 21:39306446-39306468 GTGGTAAAGACAGAGGAGGAAGG + Intronic
1179412466 21:41172744-41172766 GAGGAAAGGGAAGATGAGGGAGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179625448 21:42646488-42646510 GAGGAAAGGACGGAGGGGGAAGG + Intergenic
1179734450 21:43384010-43384032 AAGGAAAGGACAGAGGAGGGTGG - Intergenic
1179958945 21:44757669-44757691 GTGGAAGAGGCAGCTGAGGAGGG + Intergenic
1180104325 21:45607877-45607899 GAGGAAAAAACAGAAGACAATGG + Intergenic
1180121177 21:45749391-45749413 GAGGAAAACACAGAAGACGAGGG + Intronic
1180295399 22:10929662-10929684 GAGGAAGAGAGAGAGGGGGAAGG - Intergenic
1181008636 22:20027132-20027154 GAGGAAGAGAGAGATGGGGGAGG + Intronic
1181177022 22:21043739-21043761 GAGGAAAATGCAGCTGAGAAGGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181393268 22:22599405-22599427 GAAGAAAACACAGGAGAGGAAGG + Intergenic
1181416913 22:22766784-22766806 CAGGAACATACAGATGAGAAGGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181798051 22:25324562-25324584 GAGGAAATGACTGAAGTGGACGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182095436 22:27622340-27622362 GGTGATAAGACAGATGAGAAAGG - Intergenic
1182972763 22:34593296-34593318 GAGGAAAGGCCATATGAGCATGG + Intergenic
1183004301 22:34888240-34888262 GAGGGACAGACAGATGAGCAGGG - Intergenic
1183740927 22:39668206-39668228 GAAGAATAGAGAGCTGAGGAGGG + Intronic
1184119669 22:42441550-42441572 GAGGATGAGACAGAGGAGAAGGG - Intergenic
1184265133 22:43342655-43342677 GGAGAAAAGACAGATGCGGAAGG - Intronic
1184280035 22:43432130-43432152 GAGACAAAGAGAGATGAAGATGG - Intronic
1184437597 22:44488904-44488926 GGGGAAAGGAGAGAAGAGGAGGG + Intergenic
1184489382 22:44800400-44800422 GATAAAAAGACAGATCAGGCCGG - Intronic
1184572106 22:45331897-45331919 GAGGGCAAGAGAGCTGAGGAGGG - Intronic
1184689822 22:46112470-46112492 GAGGAAGAGAGAAAGGAGGAGGG - Intronic
949168770 3:972768-972790 TAGAAAAAGACAGATGAGAGAGG - Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950006270 3:9693165-9693187 GTGGAAACGACAGATATGGAGGG - Intronic
950327137 3:12121588-12121610 GAGGGAAAGAAAGAAAAGGAAGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950667177 3:14504702-14504724 GATGAAAAGACAGAGGCTGAAGG + Intronic
950973003 3:17208330-17208352 CAGGAAAAGAGAGCTGTGGATGG + Intronic
951001549 3:17566656-17566678 GAGGAAAAGGGAGAAAAGGAGGG - Intronic
951005535 3:17611571-17611593 GAGGAAAAGCAAGATGAAGATGG + Intronic
951412240 3:22379377-22379399 GAGGAAGAAAGAGAGGAGGAAGG + Intergenic
951597838 3:24336984-24337006 AAGGAAAAGACACATGGGAAAGG + Intronic
951765802 3:26197300-26197322 GAGGAAAGGACAGCAGAGAAAGG + Intergenic
952039723 3:29247534-29247556 GAGCAACAGAGAGGTGAGGAAGG - Intergenic
952196176 3:31077618-31077640 GAGGATAATACAGATAAGGGTGG - Intergenic
952492900 3:33888748-33888770 GAAGAAAAGCTACATGAGGAAGG + Intergenic
952632705 3:35488808-35488830 GAGGAAGAAAAAGAGGAGGAGGG + Intergenic
952669280 3:35946924-35946946 GAGGAAGGGACTGATGAGGAGGG + Intergenic
952734906 3:36680061-36680083 GAGGAAGAGAGAGATGGGGGAGG + Intergenic
952767807 3:36970093-36970115 GAGCAAGAGACAGTTCAGGAAGG - Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
953019725 3:39105845-39105867 GAGGAAATGCCAGGTGAGGCTGG - Intronic
953065271 3:39463820-39463842 GAGCAAACCAAAGATGAGGATGG + Intergenic
953133337 3:40161661-40161683 GAGGAAAATGCAGTCGAGGAGGG - Intronic
953156475 3:40379640-40379662 GGGGAAAATACAGAGGAGTAGGG + Intergenic
953454646 3:43032000-43032022 GAGAATAAGACAGAAGAGCATGG + Intronic
953831347 3:46300077-46300099 AAGGAAAAGAGAGGAGAGGAAGG + Intergenic
954599235 3:51854782-51854804 GAGGAAGAGACAGACAAAGACGG + Intergenic
954691332 3:52397147-52397169 GATGAAAAGACAGCTGATGGAGG - Intronic
955191421 3:56765295-56765317 GCGGAAAAGAGGGATAAGGAAGG + Intronic
955375361 3:58390887-58390909 GTGAAAAAGATAGATGAAGAAGG - Intronic
955829359 3:62984876-62984898 AGGGAAAAGGCAGATGAGAACGG - Intergenic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956122861 3:65983646-65983668 GAGGGAGAGAGAGATAAGGAGGG - Intronic
956414820 3:69014350-69014372 GAGGAAAAGACAGTGGGGGATGG - Intergenic
956468572 3:69542353-69542375 GAGGAAGAGGAAGAAGAGGAAGG - Intronic
956741402 3:72279142-72279164 GTGGAAAAGAGAGAAAAGGAAGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957013401 3:75034239-75034261 GAGGTAAAAACAGATTAGTAGGG - Intergenic
957590367 3:82189384-82189406 GAGGGAATGATAGAGGAGGAGGG + Intergenic
957811788 3:85231435-85231457 GAAAAAAAAACAGAAGAGGATGG + Intronic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958005227 3:87802052-87802074 GAGGGAAAGAAAGAAAAGGAAGG - Intergenic
958005248 3:87802110-87802132 GAGGGAAAGAAAGAAAAGGAAGG - Intergenic
958856994 3:99397673-99397695 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
958914721 3:100036309-100036331 GAGGAAAAAAAAGATGAGCCTGG + Intronic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959346416 3:105200620-105200642 GAGGAAACAAAAGATGAAGACGG + Intergenic
959497802 3:107071844-107071866 GAGGAAAAGAGAGGGGAAGATGG - Intergenic
959758563 3:109928842-109928864 GAGGAAGAGAGAGAGAAGGAGGG + Intergenic
960034786 3:113091578-113091600 GAGAAAAAGAAAGAGAAGGAGGG + Intergenic
960063871 3:113350262-113350284 GAGGAAGAGACAGACAAAGAAGG + Intronic
960063875 3:113350392-113350414 GAGGAAGAGACAGACAAAGAGGG + Intronic
960144057 3:114180480-114180502 GAGGAAAGGACACAGGAAGATGG + Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960513836 3:118581079-118581101 GAGGAGAAGAGAGAGAAGGATGG - Intergenic
960678675 3:120224229-120224251 GAAGACAATACAGATGAAGAAGG - Intronic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960853656 3:122080799-122080821 GAGGAAAACAGAGCTCAGGATGG + Intronic
961030587 3:123600069-123600091 GAGGAAGAGGAAGATTAGGAAGG - Intergenic
961238232 3:125387130-125387152 GAGGCAAAGCCAGATGATGAAGG + Intergenic
962276920 3:134021611-134021633 GAGGAAGAGACAGACAAAGAGGG + Intronic
962314660 3:134351558-134351580 GAGGAGAAAAGAGATGAGAAAGG + Intergenic
962382435 3:134908734-134908756 GAAGGAAAGAGAGGTGAGGAGGG + Intronic
962443878 3:135448142-135448164 GAGGAAAAGAAAGCTAAGAAAGG + Intergenic
962716385 3:138129367-138129389 GAGGAAAAGAGATTTGAAGATGG + Intronic
962737575 3:138339405-138339427 GAGGAAAAGGGAGGTGAGGCAGG - Intergenic
962898321 3:139735680-139735702 AAGGAAAAGACAGGGAAGGAAGG - Intergenic
962914631 3:139888824-139888846 GAGGAGAAGAGAGGAGAGGAGGG - Intergenic
963408908 3:144905198-144905220 GAGGAAGAGACAGACAAAGAGGG - Intergenic
964236436 3:154535923-154535945 GAGGAAAGGAAAGATGGGGAGGG - Intergenic
964285097 3:155109271-155109293 GAGACAATGAAAGATGAGGAAGG + Intronic
964470117 3:157043710-157043732 GTGGAAAAGGCAGGGGAGGAGGG - Intronic
964728898 3:159844102-159844124 GAAGAAATGACACAAGAGGAAGG - Intronic
964972434 3:162578330-162578352 GAGGAAGAGACAGACAAAGAAGG + Intergenic
965430828 3:168586077-168586099 GAGAAAAAAAAAGATGAAGAAGG + Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965610399 3:170537563-170537585 CAGGAAAAGAGAGATGAGAGAGG - Intronic
965743794 3:171904087-171904109 AAGGAAAAGAGAGATGGGGGAGG + Intronic
965924054 3:173956375-173956397 GAGGAAGGGAAAGAGGAGGAAGG - Intronic
966150163 3:176859141-176859163 GAGGAAAGGACAGATTGGGTAGG - Intergenic
966532078 3:180992372-180992394 GAGGAACAGAAAGGTTAGGAGGG + Intergenic
966772577 3:183517353-183517375 GAGGGGAAGAGAGGTGAGGATGG - Intronic
966916110 3:184584822-184584844 GAGGAAGAGACAGAAGAGAGAGG + Intronic
966973517 3:185066237-185066259 GAGGAAGAGAGAGGTGGGGAGGG - Intergenic
967321147 3:188196591-188196613 GAAGAAAAGAGAGAATAGGATGG - Intronic
967777999 3:193404609-193404631 GAGGAAGAGAGAGAAGGGGAAGG - Intronic
967786647 3:193504037-193504059 GAGAGAAAGAGAGATGAAGAAGG + Intronic
967842144 3:194014642-194014664 GAGGAAAAGAAACAAGAAGAGGG + Intergenic
967895361 3:194391485-194391507 GTGGAAGAGATAGATGAGCATGG + Intergenic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968323178 3:197789721-197789743 GAGCAAAAGAAAAATAAGGATGG - Intergenic
968356638 3:198113501-198113523 GAGGAAAAGACAGACGGCGGCGG + Intergenic
968374216 4:24517-24539 GTGGAAAAGACTAATGATGATGG + Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
968956241 4:3721285-3721307 GAGGGAAGGACAGCTGTGGAGGG + Intergenic
969073750 4:4560825-4560847 AAAGGAAAGACAGAGGAGGAAGG - Intergenic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969423603 4:7111153-7111175 GGGGCAAAGACAGAGAAGGACGG + Intergenic
969463456 4:7341068-7341090 AAGGAAAATACAGATGTGCATGG + Intronic
969561805 4:7953137-7953159 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
969668671 4:8577033-8577055 GCGGAAAAGAGAAAGGAGGAAGG - Intronic
970203862 4:13636171-13636193 GAGTGAAGCACAGATGAGGATGG + Intergenic
970323498 4:14898991-14899013 GAGGAAAAGAGAGGGAAGGAAGG + Intergenic
970495300 4:16618942-16618964 GAGGAAGAGACTGATGGGGGAGG - Intronic
970683679 4:18540514-18540536 GAGGAAGAGAGAGACGGGGAAGG - Intergenic
971633841 4:29031426-29031448 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
971646901 4:29217994-29218016 GAGGAAAAGGAAGATCAGAAAGG - Intergenic
971679033 4:29673369-29673391 GAGGAAAAGAAAGAAAAGAATGG - Intergenic
971742267 4:30535769-30535791 GAGGATATGAAAGATGTGGAAGG + Intergenic
971923283 4:32971647-32971669 CAGGAAAATACAGATTAGGAAGG - Intergenic
972122386 4:35720593-35720615 GAGGAAAGGCTAGGTGAGGACGG - Intergenic
972236647 4:37142332-37142354 GAGGCAGAGAGAGATGTGGATGG - Intergenic
972281473 4:37606010-37606032 GAGGAAGAGAAAGAGAAGGAAGG + Intronic
972701515 4:41498451-41498473 GAGGAAGAGAGACATGAGTATGG - Intronic
972731803 4:41802078-41802100 GAGGAAAAGAAAGTAGGGGAGGG - Intergenic
973013117 4:45102424-45102446 AAAGAAAAGAGAGAGGAGGAAGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973319710 4:48797530-48797552 AAGGAAAAGACAGAAGAGAAAGG + Intergenic
973536170 4:51884672-51884694 GAGGGAAAGACAGATGAGCTGGG + Intronic
973548853 4:52011055-52011077 GTGGAAAAGACAGATTACAAAGG + Intronic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
974080205 4:57204341-57204363 GAGGAAAATGAAGACGAGGAAGG + Intergenic
974081481 4:57217999-57218021 GAGAAAAAGACAGATGAATGTGG - Intergenic
974237638 4:59202481-59202503 GAGGAAAAGAGAGAGGGAGAGGG - Intergenic
974280609 4:59786676-59786698 GAGCAAGAGAGAGATGGGGAAGG + Intergenic
974336665 4:60556245-60556267 GAGGAAAAGATAGATGTGAATGG + Intergenic
974673452 4:65060372-65060394 GAGGAAAACACAGATTAGTATGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974704527 4:65494978-65495000 GAGGAAGAGGAAGAAGAGGAAGG + Intronic
974838432 4:67276799-67276821 GAGGAAGAGACAGACAAAGAGGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975031453 4:69623158-69623180 GAGGAACAGATGGAAGAGGATGG - Intronic
975036053 4:69684123-69684145 GAGGAACAGATGGAAGAGGATGG + Intergenic
975288691 4:72650739-72650761 GATCAGAAGACAGGTGAGGAGGG - Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975572371 4:75831380-75831402 GAGCACATGACAGATGAGAAAGG + Intergenic
976174114 4:82335111-82335133 GAGGAAGAGACAGACAAAGAGGG - Intergenic
976532890 4:86175575-86175597 GAGGAAGAGAGAGAGGAGGGAGG - Intronic
976582113 4:86749262-86749284 GAAGAGGAGACAGAGGAGGAGGG - Intronic
976930145 4:90556736-90556758 GAGGAAGAGGAAGAAGAGGAGGG + Intronic
977043766 4:92044723-92044745 GAGGAAAAGACAGAGGCAAAAGG - Intergenic
977432688 4:96952066-96952088 GAGGAAGGGCAAGATGAGGAAGG + Intergenic
977578067 4:98695789-98695811 GTGGAAAAGAGATATAAGGAAGG + Intergenic
977589804 4:98813681-98813703 GAGGAAGAGAGAGAAAAGGATGG - Intergenic
977685696 4:99845023-99845045 AAGGAAAAAGCAGCTGAGGAAGG + Intronic
978030854 4:103938780-103938802 GAGGAGAAGAGAGGAGAGGAGGG + Intergenic
978133345 4:105226647-105226669 GAGAAAAAGAGAGAGGAAGAGGG - Intronic
978187416 4:105872763-105872785 GAGGAAGAGAGAGATGGGGGAGG - Intronic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978648634 4:110972839-110972861 GAAAGAAAGACAGATGAGGCAGG - Intergenic
978747466 4:112210032-112210054 GAGGAAGAGACAGACAAAGAAGG + Intergenic
978862586 4:113468700-113468722 GAGGGAAGGCCAGATGAGAATGG - Intronic
979350437 4:119638064-119638086 GAGGAAAAGAGAGAAGCGGAAGG + Intergenic
979375455 4:119941502-119941524 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
979386955 4:120078104-120078126 GAGGAAAAGAAACAAGAGGTAGG + Intergenic
979875851 4:125890162-125890184 GAGAAAAAGTTAGATGATGATGG + Intergenic
979998058 4:127456668-127456690 GAGGAAGAGGAAGAAGAGGAGGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980638074 4:135535869-135535891 GAGGAGAAGAGAGGAGAGGAGGG + Intergenic
980914165 4:139018946-139018968 GAGACACACACAGATGAGGAAGG + Intronic
981628209 4:146786185-146786207 GAGGAAGAGAAAGACGAAGAGGG - Intronic
981887897 4:149699881-149699903 GAGGGAAAGACAGAAGGGGAGGG - Intergenic
981949182 4:150385582-150385604 GATGAACAGACAGAGGAAGAAGG + Intronic
982362724 4:154538488-154538510 GAGGAAGAGAGAGAACAGGAGGG + Intronic
982429637 4:155308021-155308043 GAGGAAGAGACAAATGTGGGTGG - Intergenic
982473500 4:155822530-155822552 GAAGAGAAGTCAGATGAGAAGGG - Intergenic
982547175 4:156748624-156748646 GAAGAAATGACTGATGAGTAGGG + Intergenic
982701563 4:158663524-158663546 GAGGAAGAGACAGACAAAGAAGG + Intergenic
983311699 4:166072383-166072405 AAAGAAAAGAAAGAAGAGGAAGG - Intronic
983351243 4:166592901-166592923 GAGGAAAAGAAAGAGGAGGGGGG - Intergenic
983878326 4:172903230-172903252 GAGGAAAACACGGTTTAGGATGG - Intronic
983897810 4:173100223-173100245 GAGGAAGAGACAGACAAAGAGGG + Intergenic
983930907 4:173452353-173452375 GAGCAAAAGCAAGAGGAGGATGG + Intergenic
984143459 4:176032493-176032515 GAGAAATAGACAGATGAGATAGG + Intergenic
984353776 4:178631002-178631024 GAGTAAAAGAAAGATGACAATGG + Intergenic
984418756 4:179492684-179492706 AGGGAAAAGAGAGAAGAGGAAGG - Intergenic
984597747 4:181689952-181689974 GGAGAAAAGACATATGTGGATGG + Intergenic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985112483 4:186560225-186560247 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985361022 4:189175754-189175776 GTGGAAAGGACACATGAGGAAGG - Intergenic
985460514 4:190101746-190101768 GTGGAAAAGACTAATGATGATGG - Intergenic
985734218 5:1568321-1568343 GGGGAAAAGAGAGATCAGGCTGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
985797409 5:1973180-1973202 GAAGGAAAGACAGAAAAGGAAGG - Intergenic
985906955 5:2846219-2846241 GAGCAAAAGGCAGAGGAAGAGGG - Intergenic
985952919 5:3237100-3237122 CAGAAACAGACACATGAGGAAGG + Intergenic
986063481 5:4213419-4213441 GAGGAGAAGTCAGAGGAGAAGGG - Intergenic
986064593 5:4223244-4223266 GAGGCTCAGAGAGATGAGGAAGG + Intergenic
986093573 5:4534918-4534940 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
986623400 5:9700514-9700536 GCAGAAAAGAGAGATTAGGAAGG + Intronic
986635145 5:9813807-9813829 GAGGCAGAGACAGATGTGGCAGG - Intergenic
986811046 5:11360174-11360196 GAAGAAAAGAGAGATGAAGAAGG + Intronic
986949039 5:13059690-13059712 GAGCAAAAGAGAGTTGGGGAGGG + Intergenic
987075485 5:14378337-14378359 GAGGTAAAGACAGTAGGGGAAGG - Intronic
987109537 5:14672376-14672398 CAGCAAGAGACAGATGAAGAAGG - Intronic
987214023 5:15714275-15714297 GAGGAAGAGAGAGAAGGGGAAGG - Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987490002 5:18568007-18568029 GAGGAAGAGAGAGAAGAGGGAGG + Intergenic
987597655 5:20021571-20021593 AAGGAAAAGACTGAAGGGGAAGG - Intronic
987822831 5:22988024-22988046 GAGGAAGAGGAAGAGGAGGAAGG - Intergenic
987896091 5:23949354-23949376 GAGGAAGAGAAAGAAGGGGAAGG - Intergenic
988275810 5:29079983-29080005 AAGGAAAAGAGAGAGGAGGGAGG + Intergenic
988287371 5:29237482-29237504 GAGGAAGAGACAGAAGGGGAAGG + Intergenic
988444587 5:31271398-31271420 AAGGTTAAGACAGAGGAGGAAGG - Intronic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
988831870 5:34995755-34995777 GAAGAAGAGACAGCTCAGGACGG + Intergenic
988897915 5:35698275-35698297 GAGACCAAGAGAGATGAGGAAGG + Intronic
988913274 5:35867758-35867780 AAGGAAAGGACAGATAAGGAAGG - Intronic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
989274150 5:39567165-39567187 GAAGAAAAGAAAGAAGAGGAGGG + Intergenic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989556826 5:42806638-42806660 GAGGAGGAGAAAGAAGAGGAAGG + Intronic
989962217 5:50429902-50429924 GGTGAAAAGACAGAGAAGGAGGG - Intronic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990496619 5:56354277-56354299 GGGGGAAAAACAGATGGGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990908390 5:60827900-60827922 GAGTGAAAGAAAGATGAAGAAGG - Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
992098631 5:73384046-73384068 GAGAAAAAGACAAGAGAGGAGGG + Intergenic
992321224 5:75614907-75614929 GAGGAAAAGAATGGTGAGGGAGG + Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992475419 5:77097161-77097183 GAGGAAAAGAGAGAAGGCGAAGG + Intergenic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992550385 5:77854096-77854118 CAGTAAAAGACAGATGACCACGG + Intronic
992629649 5:78667899-78667921 GAGGAGGATACAGATGAGGAAGG - Intronic
992874850 5:81043816-81043838 GAGGAACAGACAGATGGAGAAGG - Intronic
993015816 5:82533324-82533346 CAGGAAAAGTCTGATGTGGATGG - Intergenic
993227631 5:85187655-85187677 GCAGAAAGGAGAGATGAGGAAGG + Intergenic
993285817 5:85994604-85994626 GAAAAAAAGAAAGAAGAGGAGGG + Intergenic
993351829 5:86858974-86858996 GAGGAAAAGAGAGAAGTGGGTGG - Intergenic
993456575 5:88133987-88134009 GAGGAGGAGAAAGAAGAGGAAGG + Intergenic
993594356 5:89834112-89834134 GAGGAATTTACAGATGAGGTGGG - Intergenic
993625433 5:90219147-90219169 GATGAAAAGACTTATGAAGATGG + Intergenic
993808707 5:92445792-92445814 AAGGGAAAAACAGAGGAGGAGGG - Intergenic
993938599 5:94032366-94032388 GAGCCAGAGACAGATGAGGAGGG + Intronic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994927209 5:106132236-106132258 GAGGAAAAGATAGAAGAACAAGG + Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995682138 5:114731825-114731847 GAGGACAAGACGTTTGAGGAAGG + Intergenic
995876853 5:116799428-116799450 GAGGAGAAGACAGATAAACAGGG + Intergenic
995908351 5:117154711-117154733 GAGGAAAAGACAGAGAAAGAAGG - Intergenic
996086351 5:119309581-119309603 GAGGAAATGGCAGAAGAGCAGGG + Intronic
996500123 5:124207483-124207505 GGAGAAAAGACAGATGAGGTAGG + Intergenic
996606567 5:125329967-125329989 GAGGAAAAGAAAGAAGAAGAAGG + Intergenic
996914030 5:128690477-128690499 AAGGAAAATACAGGTGAGGTTGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997180084 5:131819404-131819426 GAGGAAGAGGCAGAGGGGGAGGG + Intronic
997191146 5:131936958-131936980 GAAGAAAAGACAGAAGAAGAGGG - Intronic
997592087 5:135080453-135080475 GAGGAAGAGAGAGATGGGGGAGG + Intronic
997715906 5:136042631-136042653 GAGAAAAAAACAAAAGAGGAAGG + Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998465796 5:142342712-142342734 GAGGAAACCCCAGAGGAGGAAGG - Intergenic
998768330 5:145513025-145513047 GAGGAAAAAACAGCTCAGAAAGG + Intronic
999006360 5:147984430-147984452 GAGGAAAAGAGAGAAAGGGAGGG + Intergenic
999267371 5:150275707-150275729 GATGAACAGCTAGATGAGGAGGG + Intronic
999505328 5:152188812-152188834 GAGCAAAAAACAGGAGAGGATGG - Intergenic
999526054 5:152406947-152406969 GAGGAAAAGAGAGCTCTGGATGG + Intronic
999645954 5:153717334-153717356 GAAGCAAAGAGAAATGAGGAGGG + Intronic
1000085655 5:157885600-157885622 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1000121435 5:158201691-158201713 GAAGGAAAGAGAGAAGAGGAGGG - Intergenic
1000320089 5:160127591-160127613 GAGCAAAAGGCAGAGGAAGAAGG + Intergenic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1001013405 5:168118812-168118834 GAGGAAAAGAAAGAGAAGGAAGG - Intronic
1001126653 5:169025476-169025498 GAAGAAAAGAAAGAAGAGCAAGG - Intronic
1001549649 5:172593757-172593779 AAGGAAAAGACAGCAGAGGTGGG + Intergenic
1001667639 5:173446671-173446693 GAGGAAAAGGCTGATGATGCAGG + Intergenic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001801787 5:174550743-174550765 GAGGAAAAGAGAGAGGACAAAGG - Intergenic
1001807461 5:174600046-174600068 GAGAAAAAGAAAGAACAGGATGG + Intergenic
1001856971 5:175021299-175021321 GTGGAAAAGACACATGAGTTGGG + Intergenic
1002109566 5:176899214-176899236 GAGGACAAGACAGCTGTGGAAGG + Intronic
1002378745 5:178809126-178809148 GAGGAAGCGACACGTGAGGAGGG + Intergenic
1002681314 5:180967518-180967540 GGGGGAGAGACAGAGGAGGAGGG - Intergenic
1002681320 5:180967538-180967560 GGGGGAGAGACAGAAGAGGAGGG - Intergenic
1002742368 5:181443078-181443100 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003033020 6:2619158-2619180 GAGGAAAACACAGATGCAGAGGG + Intergenic
1003232506 6:4267445-4267467 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003509965 6:6771436-6771458 GAGGAAAAGGAAGAAGAAGAAGG + Intergenic
1003805964 6:9726140-9726162 GAGGAAGAGACAGACAAAGAGGG + Intronic
1004188697 6:13445609-13445631 GAGGAAAAGACAGCTGGGTCTGG + Intronic
1004199391 6:13533804-13533826 AAGGAGAAGACAGAGGAAGAAGG + Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004389636 6:15199110-15199132 AAAGAAAAAACAGAAGAGGAGGG + Intergenic
1004390107 6:15202843-15202865 GAAGAAAAGAGAAATGAGAAGGG + Intergenic
1004458496 6:15813909-15813931 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
1004554268 6:16680356-16680378 AAGGAAAAGAAAGAAAAGGAAGG - Intronic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004617373 6:17303489-17303511 GAGGAAAAGACAGAGGAAGGGGG + Intergenic
1004751931 6:18570936-18570958 GACAAAAAGAAAGATGAAGATGG + Intergenic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1005390746 6:25330697-25330719 AAAAAAAAGACAGATGAGGATGG + Intronic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005992373 6:30911397-30911419 GAGGCAGAGACAAAGGAGGAGGG - Intronic
1005998121 6:30944224-30944246 GAAGAAAAGAAAGAAAAGGAAGG - Intronic
1006244502 6:32718703-32718725 AAGGAAGAGAAAGAGGAGGAAGG + Intergenic
1006302709 6:33202128-33202150 GAGGAAGAGACAGATGGGGATGG + Intronic
1006376334 6:33673558-33673580 GAGGAAAGGTCAGGTGAGGATGG - Intronic
1006405898 6:33844672-33844694 GAGGAAAGGACCGGAGAGGAAGG - Intergenic
1006597497 6:35204007-35204029 AAGGAAAAGAGAGATGGAGAAGG - Intergenic
1006912097 6:37570122-37570144 AGGGAAGAGACAGAGGAGGAGGG + Intergenic
1007274147 6:40661212-40661234 GTGGAGGAGACAGATGGGGACGG - Intergenic
1007582331 6:42966870-42966892 CAGGAAAGGACACATGAGCAGGG + Intronic
1007764790 6:44154121-44154143 GTGGCAGAGACAGATGACGATGG - Exonic
1008057744 6:46962728-46962750 GAAGAATATCCAGATGAGGAGGG - Intergenic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1008131641 6:47725901-47725923 GAAAAACAGACAGATGGGGAAGG - Intergenic
1008422733 6:51321164-51321186 GAGGTTAAGAGAGCTGAGGAAGG - Intergenic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1008554888 6:52664751-52664773 GAGGGAAGGAGAGAAGAGGAAGG - Intergenic
1008874967 6:56315657-56315679 GAGGAAGAGGGAGAGGAGGAAGG - Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009313477 6:62188023-62188045 GAGCAAGAGAGAGAGGAGGAGGG + Intronic
1009484478 6:64202766-64202788 GGGGAAAGGATATATGAGGAAGG + Intronic
1009592721 6:65693165-65693187 GAAGAAAAGAAAGAGAAGGAAGG - Intronic
1009711065 6:67321446-67321468 GAGGAAAAGAAAGAAGATTATGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010099617 6:72088920-72088942 GAGGGAAGGAGAGGTGAGGAGGG + Intronic
1010472216 6:76242180-76242202 GAGGAAAAGAGAGAAGGGGGAGG - Intergenic
1010644267 6:78368186-78368208 GAGGAAAAGAGAGATGGAGGAGG - Intergenic
1010662292 6:78585238-78585260 GAGGAAAGGAGAGAGGAAGAGGG - Intergenic
1011026505 6:82875190-82875212 GAGAGAGAGACAGATGAGGCTGG + Intergenic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011396829 6:86919142-86919164 GAGGAGAAAACACTTGAGGAGGG - Intergenic
1011543844 6:88463525-88463547 GAGGTGAAGACAGAGGAAGAAGG + Intergenic
1011594521 6:89003741-89003763 GAGGAAGAGAGAGATGGGGGAGG - Intergenic
1011749901 6:90444719-90444741 GATGAAAACACTGAAGAGGAGGG + Intergenic
1011922383 6:92595655-92595677 GACCAAAGCACAGATGAGGATGG + Intergenic
1012091410 6:94902558-94902580 GAGGAGAAGAAAGAGTAGGAAGG + Intergenic
1012526274 6:100181840-100181862 GAGGAAAAAAGAGATGGGGAGGG - Intergenic
1012526461 6:100183738-100183760 GAGGGAAAGGCAGAGGGGGAGGG - Intergenic
1012939292 6:105400600-105400622 GAGGAGAACACAGAAGAGGATGG - Intronic
1013174344 6:107664351-107664373 GAGGAAAATACAGTCCAGGAAGG + Intergenic
1013239391 6:108229380-108229402 GAGGAAAGGAAAGAAAAGGAGGG - Intronic
1013313253 6:108917395-108917417 AAGGAAAGGACTGATGAGGTGGG - Intronic
1013584782 6:111568749-111568771 GAGGAAAAGAGAGGCGAGGCTGG - Intronic
1013608526 6:111773360-111773382 GAGGGAGAGGCAGAGGAGGAGGG + Intronic
1013609187 6:111778251-111778273 GAAGAAAAGATGAATGAGGAAGG + Intronic
1013751386 6:113410746-113410768 GAGAAAAAGAAAGTGGAGGAGGG + Intergenic
1013857089 6:114586050-114586072 GAGGAAGAGGAAGAAGAGGATGG + Intergenic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014637481 6:123866241-123866263 GTGTAATAGTCAGATGAGGATGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015004624 6:128264102-128264124 GAAGAAAAGCCAGAGGAAGATGG + Intronic
1015014930 6:128400940-128400962 GAGGGAAAGAAAAATGAGCAAGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015335109 6:132028002-132028024 GCGGAAGAGAGAGATGAGGAAGG + Intergenic
1015438013 6:133212861-133212883 TAAGAAGAGACTGATGAGGAAGG + Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016371746 6:143381922-143381944 GAGGAAGAGAAAGATGGGGCGGG + Intergenic
1016474547 6:144412564-144412586 TTGCAAAAAACAGATGAGGAGGG + Intronic
1016758590 6:147713863-147713885 GAGGAAAGAACAGAAGAGGAAGG - Intronic
1017167997 6:151427776-151427798 TTGGAAAACACAGATGAGAATGG + Intronic
1017218998 6:151944176-151944198 TACGAAAAGACCGAAGAGGAGGG + Exonic
1017665117 6:156712560-156712582 GAGGAAGAGGAAGAGGAGGAAGG + Intergenic
1018763276 6:166908999-166909021 GAGGAACTGACAGTGGAGGATGG + Intronic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019377932 7:705729-705751 CAGAAAAACACAGATGAGGCGGG + Intronic
1019419358 7:943457-943479 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419362 7:943472-943494 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419366 7:943487-943509 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419384 7:943552-943574 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419423 7:943701-943723 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419427 7:943716-943738 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019419431 7:943731-943753 GAGGAAGGGAGAGAGGAGGAAGG + Intronic
1019512298 7:1423806-1423828 GAGGGAAAGACAGAGAGGGAGGG + Intergenic
1019536838 7:1533742-1533764 GAGGAAAAGAGAGAGGGGCAGGG + Intronic
1019849623 7:3541418-3541440 GAGGCAAACACACATGAGAAAGG - Intronic
1019910920 7:4100212-4100234 GAGGGAGGGACAGATGCGGATGG + Intronic
1019964073 7:4484660-4484682 GAGGAAAAGAGAGGTGAGAGAGG + Intergenic
1020044044 7:5027174-5027196 GAGGAAGAGACAGACAAAGAAGG - Intronic
1020404504 7:7816765-7816787 GAGGAAAGGACAGATAAGCAAGG - Intronic
1021018417 7:15564870-15564892 GAGGACGAGACAGAAGAGGGAGG - Intergenic
1021068252 7:16203619-16203641 GAGGAAGAGACTGATGAGAGAGG + Intronic
1021146487 7:17095371-17095393 GAAGAGAAGGCAGAGGAGGATGG + Intergenic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022627177 7:32049474-32049496 GAATAAAAGAGGGATGAGGAAGG + Intronic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1022958680 7:35404285-35404307 GAGGAAGAGAGAGAAGAAGAGGG + Intergenic
1023002513 7:35825280-35825302 AAGCAAAAGTCAGATGAGGAAGG - Intronic
1023105934 7:36763376-36763398 GATGAAAGGACAGATCAGGAAGG - Intergenic
1023190644 7:37577502-37577524 GAGGACAAAACAGCTGAGGACGG - Intergenic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023269473 7:38445935-38445957 GAGGAAGAGAGAGAGGAGGGAGG - Intronic
1023331186 7:39118687-39118709 GAAGAACAGACAAATGAGAAAGG + Intronic
1023473347 7:40549648-40549670 GAGAAAAAGACATTTGAGGAGGG + Intronic
1023589390 7:41765115-41765137 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023876473 7:44289011-44289033 GAGGAGGAGACAGAGGCGGATGG - Intronic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1024029226 7:45442912-45442934 GAGGAAAGGGGAGAAGAGGAAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024851620 7:53724290-53724312 GAGAGAAAGAGAGATGAGGTGGG - Intergenic
1024869555 7:53946887-53946909 GAGCAAGAAACAGATGAGGTTGG - Intergenic
1024924390 7:54598035-54598057 GCGGAAAAAATGGATGAGGAAGG - Intergenic
1025008701 7:55377476-55377498 GAAGACGAGACAGAAGAGGAGGG - Intronic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025235466 7:57231984-57232006 GAGGACAAGTGAGATGAGGTTGG - Intergenic
1026076233 7:67172119-67172141 GAGAAAAAGACAGCTGAAAAGGG - Intronic
1026159090 7:67852942-67852964 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1026188567 7:68103624-68103646 GAGGGAAAGAAAGAAAAGGAAGG + Intergenic
1026280750 7:68919799-68919821 GAGGAAGAGAGAGAGGAGGGAGG + Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1026700624 7:72640170-72640192 GAGAAAAAGACAGCTGAAAAGGG + Intronic
1026857256 7:73762918-73762940 GAGAAAAAGAAAGATGGGGGAGG - Intergenic
1027234202 7:76288111-76288133 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1027254198 7:76420096-76420118 GAGGAAGAGAAAGAAGAGGCTGG - Intronic
1027297810 7:76796183-76796205 GAGGCAGAGAAAGATAAGGATGG - Intergenic
1027500907 7:78950080-78950102 GAGGAAAAGAGAGGGGAGGCAGG - Intronic
1027679709 7:81205093-81205115 GAGGAAGAAACAGAAAAGGAGGG + Intergenic
1027794757 7:82678687-82678709 GAGGAAAAAAATGCTGAGGATGG - Intergenic
1028114257 7:86979895-86979917 GTGGAAAAAAGAGATGAGAAAGG - Intronic
1028225180 7:88242193-88242215 GAATAGAACACAGATGAGGAAGG - Intergenic
1028759915 7:94484210-94484232 GAGGAAAAGAGAGAGGAACAAGG - Intergenic
1029419214 7:100463816-100463838 AAGGAAAGGACAGCTGGGGAGGG - Intronic
1029485957 7:100840611-100840633 GAGGAAAAGACAGACAGAGAGGG + Intronic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1029815212 7:103086893-103086915 GAGAATAAGACAGAAGAGGGAGG + Intronic
1029821866 7:103153977-103153999 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1030384046 7:108847326-108847348 GAGGAAAGGAGAGCAGAGGAGGG - Intergenic
1030607685 7:111655365-111655387 GAGGAAGAGAGAGAAGAGGGAGG + Intergenic
1030628893 7:111873594-111873616 GAGAAACAGAAAGATGATGAGGG + Intronic
1031214857 7:118877247-118877269 GGGGAAAGGAAAGAAGAGGAAGG + Intergenic
1031284728 7:119852085-119852107 GAGGAAAAGTCAGATAAACATGG + Intergenic
1031371481 7:120972764-120972786 GAGCAAAAGAAAAATGAGAAAGG + Intronic
1031963834 7:128013033-128013055 GAGGAAAACAAAGATGAGCCAGG - Intronic
1032090490 7:128909291-128909313 TAGGAACAGAGAGAGGAGGAGGG + Intronic
1032221606 7:129998750-129998772 GAGGAGGAGACACTTGAGGATGG + Intergenic
1032306652 7:130739717-130739739 GAAGAAAAAACAGATGATGTTGG - Intergenic
1032501506 7:132403620-132403642 GAGGAAAAGCCAGGCCAGGAAGG - Intronic
1032575520 7:133049576-133049598 GAGGAATACAAAGATGAGTAAGG - Intronic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1032738450 7:134714057-134714079 GAGGAAGAGACAGAGGTGGGAGG - Intergenic
1032769818 7:135039961-135039983 GAGGAAGAGAACGAGGAGGAGGG + Intronic
1032887627 7:136158639-136158661 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
1033257450 7:139814522-139814544 GAGGAAAGAACAGATGTGGAAGG + Intronic
1033591362 7:142811450-142811472 GAGGAAAAGGCTGATGTGGATGG - Intergenic
1033613485 7:142988133-142988155 GAGGGAAAGACAATTGAGGGAGG + Intergenic
1033669658 7:143478823-143478845 CCGGAAAAGAAAGGTGAGGATGG + Intergenic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033977427 7:147119026-147119048 GAGGAAAAGAAGGAAGAGCAGGG + Intronic
1034579544 7:152030668-152030690 GAGGAAGAGACAGACAAAGAGGG - Intronic
1035237606 7:157508974-157508996 GAGAAAGAGAGAGAGGAGGAGGG + Intergenic
1035280841 7:157776907-157776929 GAGGAGAAGAGCGAGGAGGAGGG - Intronic
1035516107 8:233065-233087 GAGGAGAAAACAGAGGAGGGAGG + Intronic
1035633438 8:1126335-1126357 GAGACACAGGCAGATGAGGAGGG + Intergenic
1035633446 8:1126373-1126395 GAGACACAGGCAGATGAGGAGGG + Intergenic
1035633454 8:1126411-1126433 GAGACACAGGCAGATGAGGAGGG + Intergenic
1035633462 8:1126449-1126471 GAGACACAGGCAGATGAGGAGGG + Intergenic
1035715634 8:1752286-1752308 GTGGACAAAACAGAGGAGGAGGG + Intergenic
1035750454 8:1992381-1992403 GAGGAACAGGCAGGGGAGGAAGG + Intronic
1035786377 8:2264405-2264427 GAGGAAAACACAGAGGGGGCAGG - Intergenic
1035806430 8:2457311-2457333 GAGGAAAACACAGAGGGGGCAGG + Intergenic
1035840794 8:2810235-2810257 TAGGAAAAGACCCCTGAGGAAGG - Intergenic
1035974338 8:4290533-4290555 GGGGAAAACAAAGATGAAGAAGG + Intronic
1036208629 8:6824273-6824295 GAGGAAGGGAGAGATGAAGATGG + Intronic
1036614082 8:10374936-10374958 GAGCAAGAGAGAGAGGAGGAGGG - Intronic
1037351117 8:17957608-17957630 GAGGAAGAAGCAGAAGAGGAGGG + Exonic
1037370882 8:18177167-18177189 TGGGAAGAGACAGATGAGGAAGG - Intronic
1037540461 8:19865661-19865683 GAGGGAAAGAGAGATAAGGAAGG + Intergenic
1037691297 8:21183495-21183517 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
1037886693 8:22599493-22599515 GAGGAAGAGCGAGACGAGGAAGG - Intronic
1037899918 8:22681973-22681995 GAGAAAAATACAGCAGAGGAAGG - Intergenic
1037911011 8:22743571-22743593 GAGGAAAAGGCAGCTCCGGAGGG - Intronic
1038249451 8:25889506-25889528 AAGGAAAACACAGAACAGGATGG + Intronic
1038379402 8:27078668-27078690 GAGGAAAAAACAAATGGGAAAGG + Intergenic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038741786 8:30223083-30223105 GAGGGAAAGACAAAAAAGGAAGG - Intergenic
1038937558 8:32269056-32269078 GAGGAAAAGAGAGGGAAGGAGGG - Intronic
1039129202 8:34242505-34242527 GAGAGGAAGAGAGATGAGGAGGG + Intergenic
1039317294 8:36387758-36387780 GAGGAAGAGGAAGAGGAGGAAGG - Intergenic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1039393925 8:37206635-37206657 GAGGAAAAGAAAGATAAGTGAGG + Intergenic
1039405391 8:37308283-37308305 GAGGAAGAGAGAGATGAGGGAGG + Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039821133 8:41136549-41136571 AAGTAAAAGACAGTAGAGGAAGG - Intergenic
1040971030 8:53137907-53137929 GAGGAAGAGACAGATAAAGAAGG - Intergenic
1040993557 8:53378276-53378298 GAGGAAGAGACAGAGGAAAAAGG - Intergenic
1041087488 8:54270313-54270335 GAAGAGAAGACAGGTGAGCAGGG + Intergenic
1041570121 8:59328402-59328424 GAGGAAGAGAAAGAGGAAGAAGG - Intergenic
1041664779 8:60432682-60432704 GAGGAAAAGAAAGACAAGAAAGG + Intergenic
1041669087 8:60475277-60475299 GAGGAAGAGGTGGATGAGGAAGG - Intergenic
1041757357 8:61329195-61329217 GAGAGAGAGAGAGATGAGGAGGG - Intronic
1041855663 8:62451327-62451349 GAGGAGAGGACAGGAGAGGAGGG - Intronic
1042182291 8:66103232-66103254 TAGAAAATGACAGATGATGATGG - Intergenic
1042390284 8:68226577-68226599 GAGGAAAACTCTGATAAGGATGG - Intronic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042800295 8:72711140-72711162 GAGGAAAAGACAGCTGAATAAGG + Intronic
1042883758 8:73524318-73524340 GAGGAAAGGACAGAAGAGGTAGG + Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043184319 8:77126396-77126418 GGTGAAGAGACAAATGAGGAGGG - Intergenic
1043208679 8:77481941-77481963 GTGGAAAAGATATATGAAGAGGG + Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043613425 8:82093844-82093866 GAGGAAGAGACAGACAAAGAAGG - Intergenic
1044030570 8:87230112-87230134 GAGGAACAGAGAGAAGAGGGAGG + Intronic
1044152030 8:88791891-88791913 GAGGAAAAGAAAGAAAAGAAAGG - Intergenic
1044286460 8:90416297-90416319 GAGGAAAAGAATTTTGAGGATGG - Intergenic
1044345919 8:91104261-91104283 GAGGAAAGGACAGCTGAAGGTGG - Intronic
1044360979 8:91283280-91283302 GAGGAAGTGAAAGATGGGGAAGG + Intronic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044726380 8:95197623-95197645 GAGGCAAAGGCAGATGGGGAGGG - Intergenic
1044899753 8:96931555-96931577 GAGGAGTAGACAGAGCAGGAAGG + Intronic
1045349168 8:101322579-101322601 TGGGAAAAGACAGATGACCAGGG + Intergenic
1045478037 8:102569667-102569689 GAGGAAAAGAGAGGAGGGGAGGG - Intergenic
1045674057 8:104588920-104588942 GAGGAGGAGACGGAGGAGGAGGG + Exonic
1045743672 8:105390742-105390764 AATGGAGAGACAGATGAGGAAGG + Intronic
1045938149 8:107706618-107706640 CAGAGAAAGACAGAAGAGGAGGG - Intergenic
1046343911 8:112896888-112896910 CAAGAAGAGACAGATGAGGCAGG - Intronic
1046628899 8:116604083-116604105 GGGAAATAGACAAATGAGGAAGG + Intergenic
1046688947 8:117260985-117261007 GAGTACAAGACAGGTGAGCAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046846162 8:118919079-118919101 GAGGAAATGCAAGATGAGCATGG + Intergenic
1046860701 8:119088132-119088154 GAGAAAAAGAGAGAGAAGGAAGG + Intronic
1046945308 8:119968860-119968882 GAGAAAAAGTAAGATGAGGCTGG + Intronic
1047150245 8:122252714-122252736 GGGGAAAAGACAAAAGAAGAAGG + Intergenic
1047187274 8:122645509-122645531 GAGGGCAAGAGAGATGGGGAAGG - Intergenic
1047214989 8:122869095-122869117 GAGGACAAGAGAGAAGAGGAGGG - Intronic
1047389271 8:124437024-124437046 GGGGAAATGAGAGATGAGAAAGG + Intergenic
1047425957 8:124747376-124747398 GAGGGAAAGAAAGAAAAGGAGGG - Intergenic
1047691327 8:127357747-127357769 CAGGAAAAGAAAGAGAAGGAAGG - Intergenic
1047788122 8:128174340-128174362 GAGGAGAAGACATCTGAGAAAGG + Intergenic
1047902759 8:129442033-129442055 GATAAAGAGACAGATGAAGAAGG - Intergenic
1047956559 8:129981041-129981063 GGGAAGAAGACAGAGGAGGAAGG + Intronic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048224495 8:132571583-132571605 GAGGAGAAGAGAGAGGAGAAAGG + Intergenic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1048326147 8:133440920-133440942 GAGAAAAGGAGAGGTGAGGAGGG - Intergenic
1048427578 8:134336958-134336980 GAGGAAAAGAGAAATCAGTAGGG + Intergenic
1048531403 8:135253523-135253545 TAGGGAAAGAAAGAAGAGGAGGG + Intergenic
1049086411 8:140481722-140481744 GAGGAACCTACAGATGTGGAGGG - Intergenic
1049253281 8:141600731-141600753 GGGGAAAAGGCAGGTGAGGCTGG + Intergenic
1049328735 8:142038579-142038601 GAGGGAAAGGCATTTGAGGATGG - Intergenic
1049877378 8:145033677-145033699 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1050362326 9:4842336-4842358 GAGGAAAAGAGAGTAAAGGAGGG + Intronic
1050507080 9:6359771-6359793 GGGGAAAAGGCAGGTGAGGCAGG + Intergenic
1050516385 9:6448281-6448303 AAGGAAAACACAGTTGTGGAAGG + Intronic
1050881214 9:10702558-10702580 GAGGAAGAGAGAGAGGGGGAAGG + Intergenic
1050910454 9:11062764-11062786 GAGGGAAAAACAGAAAAGGATGG - Intergenic
1050922650 9:11224756-11224778 GAGAGTAAGACAGAGGAGGAAGG + Intergenic
1050969089 9:11846329-11846351 GAGGGAAAGAAAGATGGGGAAGG - Intergenic
1051325780 9:15966388-15966410 GAGGAAATGGTAGATGAGGCTGG + Intronic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1051935682 9:22440155-22440177 GAGTAAAAGACAGACAAAGAGGG + Intergenic
1052417909 9:28201769-28201791 GAGGAAAAGAGAGGGGAGAAAGG - Intronic
1052500643 9:29285195-29285217 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1052538767 9:29779813-29779835 GAGGAAAAGGAAGATGAGCGTGG - Intergenic
1053202319 9:36161229-36161251 GGGGAAAAGGAAGAAGAGGAGGG + Intronic
1053222978 9:36327009-36327031 GGGGAGAAGACAGAGGAGGGAGG + Intergenic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055122867 9:72682949-72682971 GAGGAAGAGAGAGAAGGGGAAGG + Intronic
1055399567 9:75908694-75908716 GAGGAAATGACATCTGAGAAAGG - Intronic
1055538860 9:77279367-77279389 CAGAAAAAGAGAGAAGAGGAAGG - Intronic
1055735804 9:79328718-79328740 GAGGAAGAGAGAGAAGAGGGAGG + Intergenic
1056508957 9:87284523-87284545 GAGGAAAAGAGAAATGGAGAGGG + Intergenic
1056650686 9:88458674-88458696 GAGAGAAAAACACATGAGGAGGG + Intronic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1057332640 9:94129904-94129926 GAGGAAGAGAGAGAAGAGGGAGG - Intergenic
1057369433 9:94456904-94456926 GAGGACAAGACAGGACAGGAAGG - Intronic
1057820914 9:98329826-98329848 GAGGAGAGGAGAGATGGGGAGGG - Intronic
1057982978 9:99681004-99681026 GAGGAAGAGAGAGATGGAGAAGG + Intergenic
1058095366 9:100854232-100854254 GAGGAAATGTGAGATGAGGTTGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058349399 9:104003421-104003443 GTGGAAAAGGGAGAAGAGGAAGG + Intergenic
1058541369 9:106015787-106015809 GAGGAAAAGGCAGAGGGGGTGGG - Intergenic
1058562620 9:106245918-106245940 GAGGAAAAGACACCTGGTGAAGG - Intergenic
1058830501 9:108812100-108812122 GAGGAAGAGAGAGTTCAGGAGGG - Intergenic
1059354234 9:113687092-113687114 GAGGAAAGGAGGGAGGAGGAGGG + Intergenic
1059496214 9:114711404-114711426 GAGCCAGAGACAGATGGGGATGG + Intergenic
1059754372 9:117278656-117278678 TAGGAAAAAACAGAGAAGGAAGG + Intronic
1059796812 9:117706542-117706564 GAGGGCAAGCCAGATCAGGAGGG - Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060085038 9:120690796-120690818 TAGGATAGGACAGAGGAGGAGGG + Intronic
1060165717 9:121412850-121412872 GAGGGAGAGACAGAGGAGGGAGG - Intergenic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060572191 9:124652270-124652292 GCTGATAAGACAGTTGAGGAGGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060727559 9:126016416-126016438 GAGGAGACGGCAGATGAGGAAGG + Intergenic
1060922167 9:127428864-127428886 GAGGAAAACACAGGAGAGGAAGG + Exonic
1061147497 9:128808496-128808518 GAGGTAGAGACAGAGAAGGAGGG - Exonic
1061244807 9:129396026-129396048 GATGGAAAGACAGATGGGGATGG + Intergenic
1061282015 9:129602870-129602892 GAGGAAAGGAGAGAGGAGGAGGG + Intergenic
1061400362 9:130365086-130365108 GAGGAGCAGACAGGTGAGGAAGG - Intronic
1203446832 Un_GL000219v1:64533-64555 GAGGAAAAGAGAGAGGGGGAAGG - Intergenic
1203608277 Un_KI270748v1:74297-74319 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1185499197 X:584537-584559 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499209 X:584582-584604 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499219 X:584624-584646 GAGGAAGAGAAAGAGGAGAAGGG + Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185499236 X:584681-584703 GAGGAAGAGAAAGAGGAGAAGGG + Intergenic
1185499269 X:584836-584858 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499280 X:584887-584909 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185662009 X:1735515-1735537 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1185803288 X:3032597-3032619 GAGGGAGAGACAGAAGAGGGAGG + Intronic
1185913542 X:4009017-4009039 GTGGAAAAGAGAGATAAGGAAGG + Intergenic
1186024826 X:5297687-5297709 GAGGGAAAGACAGAGGAAGAGGG - Intergenic
1186148662 X:6650895-6650917 GAGAGGAAGACAGATGAGCAAGG + Intergenic
1186222023 X:7359413-7359435 GAGGAAAGGAAAAATGAGAATGG + Intergenic
1186268014 X:7852497-7852519 GAAGAAAAGAGGGATGAGAAGGG + Intergenic
1186338330 X:8616349-8616371 GAGGAATAGGGAGATGAAGAAGG - Intronic
1186578722 X:10793926-10793948 GAGGAAAGAAGAGAAGAGGAAGG - Intronic
1186701389 X:12093832-12093854 GAGAACTAGACAGATGAGGCAGG - Intergenic
1186795141 X:13039833-13039855 GATGAGCAGAAAGATGAGGAAGG - Exonic
1187071350 X:15892017-15892039 GAGGAAAAGAGAGATGGGGGAGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187319578 X:18227699-18227721 GAGAAAAAGAGAGAGGAGGGAGG + Intergenic
1187402929 X:18978346-18978368 GAGGAAAAGGCTGCTGGGGAGGG - Intronic
1187521258 X:20016206-20016228 GAGGAAAAGAAAAAACAGGAAGG - Exonic
1187536804 X:20148426-20148448 GTGGAAGAGGCAGAAGAGGAGGG + Intergenic
1187718484 X:22127910-22127932 GAAGAAAAGGCAGAGGAGGGAGG + Intronic
1187722119 X:22162027-22162049 GAGAAAGAGAAAGAGGAGGAAGG + Intronic
1187815655 X:23228841-23228863 GAGGTAAAGACTGAAGAGAAAGG + Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188256463 X:27966992-27967014 GAGGAAGAGGAAGAAGAGGAGGG - Intergenic
1188598092 X:31925982-31926004 GAGGAAGAGAGTGATGATGATGG + Intronic
1188660591 X:32753063-32753085 GAGGAAAATACAGGTGGGGATGG - Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189156489 X:38762463-38762485 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
1189219412 X:39358262-39358284 GAATAAAAGATAAATGAGGAGGG - Intergenic
1189246763 X:39569275-39569297 AAGGAAAAGAGAGAGGAGGGAGG - Intergenic
1189286122 X:39853676-39853698 GGGGGAAAGAGAGAAGAGGAAGG + Intergenic
1189351620 X:40279874-40279896 GAGGCAAAGGGAGCTGAGGAAGG - Intergenic
1189575809 X:42352050-42352072 GTGGAAAAGACAGTGGAGAAAGG + Intergenic
1190559545 X:51673380-51673402 GGGGAAAAGTCAGATGAGTCCGG - Intergenic
1190564746 X:51719941-51719963 GGGGAAAAGTCAGATGAGTCCGG + Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190753651 X:53382450-53382472 GAGGGAAGGACAACTGAGGATGG + Intronic
1191006246 X:55714198-55714220 GAGGAAGAAACAGATAAAGAAGG - Intergenic
1191989692 X:67020698-67020720 GAGGAAAATACATATGTGAATGG + Intergenic
1191995430 X:67089915-67089937 GATGAAAAGACAGACCAAGAGGG + Intergenic
1191998800 X:67126187-67126209 GAGGAAGAGAGAGCTGAGGGAGG - Intergenic
1192831101 X:74751759-74751781 GAGGGAAGGAAAGAAGAGGAAGG - Intronic
1193166094 X:78282138-78282160 GAGGAAAGGACATTTCAGGAAGG - Intronic
1193332815 X:80255010-80255032 GAGGAAGAGAGAGAAGAGGCAGG - Intergenic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1194206171 X:91014472-91014494 GAGTAATAGAGAGAGGAGGAAGG + Intergenic
1194372176 X:93087928-93087950 GAGGAAAAGAGAGAAGGGGCAGG - Intergenic
1194641422 X:96407823-96407845 GAAGAAAAGGCTGAGGAGGAGGG + Intergenic
1194686521 X:96924752-96924774 GAGGAAGAGAGAGAAGGGGAAGG + Intronic
1195157774 X:102141213-102141235 GAAGAAAAGCCAGACGCGGAGGG - Exonic
1195275140 X:103274481-103274503 GAGGGAAAGCCAGAGGATGAGGG - Exonic
1195308677 X:103609161-103609183 GAAGAAAAGCCAGACGTGGAGGG + Exonic
1195308684 X:103609197-103609219 GAGGGAAAGAGAGAGGATGAGGG + Exonic
1195449960 X:105000044-105000066 GAGGAAAAAGAAGTTGAGGAAGG - Intronic
1195570875 X:106397432-106397454 GAGCAAAAGAGAGATGAGGGAGG - Intergenic
1195989897 X:110672067-110672089 GAGGAACAGACAGAGGAGGGGGG + Intergenic
1196212750 X:113013604-113013626 GAGAGAGAGACAGAGGAGGAAGG + Intergenic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1196821405 X:119703986-119704008 AAGGAAAAAACAGATGAAGCTGG - Intergenic
1197480238 X:126974794-126974816 GAGCAAGAGAGAGAGGAGGAAGG + Intergenic
1197636021 X:128915633-128915655 AAGGAAAAGACAGAAGAGGAGGG + Intergenic
1197852428 X:130877420-130877442 GGGGAAAGGACAGAAGAGGGAGG - Intronic
1197863644 X:130995988-130996010 GAGGAAGAGAGAGAAGAGGCAGG - Intergenic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198479698 X:137030343-137030365 GAAGAAAAGCCAGATGATTATGG + Exonic
1198734793 X:139773380-139773402 GAGGAAGAGACAGCAGAGGGCGG + Intronic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199283833 X:146034484-146034506 GAGGAGGAGTCAGATGAGGAAGG + Intergenic
1199333246 X:146586563-146586585 GGGGAAAAGAGAGAGGGGGAAGG - Intergenic
1199637541 X:149827394-149827416 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1199637544 X:149827438-149827460 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1199637547 X:149827480-149827502 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1199637554 X:149827602-149827624 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1199663812 X:150080951-150080973 AAGGAAAAGACAGTAGAGGAAGG - Intergenic
1199678340 X:150206571-150206593 GAGCAAGAGCCAGCTGAGGAAGG - Intergenic
1199779462 X:151044917-151044939 GAGGAAGAGACAGAAGAGGGAGG - Intergenic
1199850429 X:151721969-151721991 CATGAGAAGACAGGTGAGGAGGG + Exonic
1199982788 X:152929917-152929939 GTGGAACAGAAAGATGAAGAGGG - Intronic
1200052417 X:153442001-153442023 GAGAAAGAGACAGGGGAGGAAGG + Intergenic
1200251106 X:154554282-154554304 GAGGCAGATGCAGATGAGGAGGG + Intronic
1200551927 Y:4589293-4589315 GAGTAATAGAGAGAGGAGGAAGG + Intergenic
1200680229 Y:6201972-6201994 GAGGAAAAGAGAGAAGGGGCAGG - Intergenic
1200694712 Y:6348764-6348786 GAGGAAGAGACAGACAAAGAAGG - Intergenic
1200694718 Y:6348846-6348868 GAGGAAGAGACAGACAAAGAGGG - Intergenic
1200775249 Y:7164697-7164719 GAGGAAGAGGAAGATGAGAAAGG - Intergenic
1201040559 Y:9825864-9825886 GAGGAAGAGACAGACAAAGAGGG + Intergenic
1201040565 Y:9825946-9825968 GAGGAAGAGACAGACAAAGAAGG + Intergenic
1201146626 Y:11068157-11068179 GAGGGAGAGACAGAGGGGGAGGG + Intergenic
1201343343 Y:12956957-12956979 GAGGAAGAGAGAGAGGAGGAAGG + Intergenic
1201590384 Y:15608521-15608543 GAAGAAAGGAAAAATGAGGATGG + Intergenic
1201625595 Y:16011691-16011713 GAAGAAAAGAAACAGGAGGAAGG + Intergenic
1201629668 Y:16056266-16056288 AAGGAAAAGATAAATGAGCAAGG - Intergenic
1201645760 Y:16229950-16229972 GAGGAAAAGACAGAGGAAGAGGG + Intergenic
1201657053 Y:16355366-16355388 GAGGAAAAGACAGAGGAAGAGGG - Intergenic
1202074455 Y:21024428-21024450 GAGGAAGAGACAAAGGAGAAAGG - Intergenic