ID: 1078443021

View in Genome Browser
Species Human (GRCh38)
Location 11:11383165-11383187
Sequence TGCCCTGAGCAGGCCCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078443021_1078443027 29 Left 1078443021 11:11383165-11383187 CCTCTCCGGGCCTGCTCAGGGCA 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1078443027 11:11383217-11383239 CTTAGACGCCAAGGAAACACAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1078443021_1078443028 30 Left 1078443021 11:11383165-11383187 CCTCTCCGGGCCTGCTCAGGGCA 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1078443028 11:11383218-11383240 TTAGACGCCAAGGAAACACAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1078443021_1078443026 20 Left 1078443021 11:11383165-11383187 CCTCTCCGGGCCTGCTCAGGGCA 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1078443026 11:11383208-11383230 TTCTTCAGACTTAGACGCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078443021 Original CRISPR TGCCCTGAGCAGGCCCGGAG AGG (reversed) Intronic
900604108 1:3516223-3516245 TGCCCTGAGCTGGCGCAGGGAGG + Intronic
900645320 1:3706358-3706380 TGCCCGCCGCAGGCCCGGGGAGG + Intronic
900645337 1:3706403-3706425 TGCCCGCCGCAGGCCCGGGGAGG + Intronic
900678783 1:3904578-3904600 TGCCCTGACCTGGCCGGGTGGGG - Intergenic
900779405 1:4607920-4607942 TGCACTGATCTGGCCGGGAGAGG - Intergenic
901230919 1:7641349-7641371 TGCCATCAGCAGGGCCTGAGGGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902096568 1:13950654-13950676 AGGCCTGAGCAGACCAGGAGAGG + Intergenic
902529523 1:17081655-17081677 TGCCCTGAACAGGCTGGGGGAGG - Intronic
902561378 1:17279728-17279750 TACCATGAGCAGGCCCCGAGGGG - Intronic
904345414 1:29865068-29865090 TGTCCTGAGCAGGCAGTGAGAGG + Intergenic
905110087 1:35588597-35588619 TGCCTTGAGAAGGCCTGAAGAGG - Intronic
905470010 1:38184856-38184878 TGTCCTCAGTAGGCCCTGAGTGG + Intergenic
905796639 1:40819707-40819729 TCCCCTGACCAGCCCAGGAGAGG + Intronic
906517587 1:46448657-46448679 TCCCCCGAGCAGGCGAGGAGAGG + Intergenic
909436825 1:75651808-75651830 AGACCTGAGCAGGGCAGGAGAGG + Intergenic
909907875 1:81221320-81221342 AGCCCTGAGGAGACCCGTAGTGG - Intergenic
910887324 1:91978708-91978730 TCCCCTGTGCTGGCCCGGCGCGG + Intronic
912207477 1:107524343-107524365 CACCCTGAGCAGGCTCTGAGAGG - Intergenic
916743248 1:167664253-167664275 TGCCCTGGGCTGGACAGGAGTGG + Intronic
917846775 1:179026257-179026279 TGCCCTGAGCCGTCCCCGAGTGG + Intronic
917869577 1:179229538-179229560 TGCCGTGAGGAGGCCGGGTGCGG - Exonic
919365743 1:196658713-196658735 TTACCTGAGCAGGCCGGGCGCGG - Intronic
919792183 1:201299157-201299179 TGCCCAGAGACAGCCCGGAGTGG + Intronic
920179824 1:204125774-204125796 TGCTCTGAGGAGGCCTGGAGGGG + Intronic
920261683 1:204692595-204692617 TGCCCTGAGCACTCCTGGATGGG - Intergenic
922570858 1:226634068-226634090 TTGCCTGAGCAGCCCTGGAGAGG + Exonic
922586069 1:226736173-226736195 GGCCCTGAGGAGGCCCGAAGTGG - Exonic
923794015 1:237135960-237135982 TGGCCTGAGCAGGGCCACAGAGG + Intronic
1062866745 10:862397-862419 TGCACTGGGCAGGGCTGGAGAGG - Intronic
1062986727 10:1776123-1776145 TGACATGAGCAGGGCAGGAGAGG + Intergenic
1066048318 10:31613625-31613647 TCCCCTGACCAGGCCATGAGGGG + Intergenic
1067661609 10:48240328-48240350 TGCCCTAAGCAGTCCCTGCGTGG - Intronic
1067693669 10:48520373-48520395 AGCCCTCAGCAGCCCAGGAGGGG + Intronic
1069637035 10:69931196-69931218 TGGCCAGAGCAGACCCAGAGTGG + Intronic
1071481838 10:86070454-86070476 TGCCCTGACCAGGCTGGGATGGG + Intronic
1071489512 10:86126786-86126808 TCCCCTGAGAAGGCCTGGTGTGG - Intronic
1073114828 10:101085894-101085916 TGGCCTGAGCAGGCAAAGAGTGG + Intergenic
1074150555 10:110755895-110755917 GGCCCTGAGCTGCCCTGGAGTGG + Intronic
1074591824 10:114821585-114821607 CGCCCTGAGAAAGCCGGGAGAGG + Intergenic
1074692177 10:116016172-116016194 TGCCCTGAGGAGGTACGGGGAGG + Intergenic
1074975087 10:118573556-118573578 TGTCCTGAGCATTCCCAGAGAGG - Intergenic
1075668626 10:124248057-124248079 TGCCCTGCGCAGGCAGTGAGTGG + Intergenic
1076138842 10:128064012-128064034 GGCCCTGAGCAGGGCCGGGCAGG - Intronic
1076843729 10:133058902-133058924 CGCCCTGAGGAGGCCGGGAGGGG - Intergenic
1076991935 11:279988-280010 AGGCCTGAGCAGGGCCGGGGAGG + Intronic
1077043091 11:533139-533161 TGCCCTGAGCCAGGCCGGAGCGG - Intronic
1077610925 11:3642636-3642658 GGCCCAGAGCAGGCAGGGAGTGG - Intergenic
1077917623 11:6621700-6621722 TGCCCAGGGCAGGCTCAGAGTGG + Exonic
1078269408 11:9780976-9780998 TGGCCTGAGCAGGGCCATAGAGG + Intronic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1079332743 11:19547111-19547133 TGCCATGTGCAGGGCAGGAGAGG - Intronic
1079695572 11:23478037-23478059 TGCCCTGAGGAGGCTGGGAGGGG + Intergenic
1080540244 11:33257827-33257849 AGCCCTGAGCATGTCCGGGGTGG - Exonic
1080952308 11:37049294-37049316 AGCCATGAGCAGGGCAGGAGAGG + Intergenic
1083673613 11:64313799-64313821 GGCCATGAGCAGGCAGGGAGGGG - Intronic
1083682872 11:64359315-64359337 TGCCCGGGGCAGGCCGGGACGGG + Intronic
1083710956 11:64548050-64548072 TGTCCTGAGCATGACCGGGGCGG + Intergenic
1084118750 11:67056825-67056847 TGCGCGGGGCAGGCCCGGCGGGG - Exonic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1084489568 11:69471107-69471129 GGCGCTGAGCAGGCCCAGGGAGG + Intergenic
1085423135 11:76380867-76380889 TGCCCTGAGGAGGCGGGGAGGGG - Exonic
1088656428 11:112004383-112004405 TGCCTAGAGCAGGGACGGAGGGG - Intronic
1089773687 11:120821174-120821196 TGATCTGAGAAGGCCCAGAGTGG + Intronic
1090208283 11:124897669-124897691 TGCCCTGAGCAGGCCTTGGATGG + Intronic
1090247952 11:125230061-125230083 TGGCCTGGGCAGGGCCTGAGGGG + Intronic
1090670672 11:128943003-128943025 TGTCCTTGGCAGGCCCGCAGTGG + Intronic
1092944252 12:13438579-13438601 TGCCCTGAACAGTCCAGGGGCGG - Intergenic
1096743990 12:53713715-53713737 TGTCCTCAGCTGGCCCAGAGAGG + Exonic
1098431650 12:70426002-70426024 TGACCTGAACAGGCCAGGCGGGG + Intronic
1101772159 12:107761260-107761282 TGCCGTGCGCACGCGCGGAGGGG - Intronic
1103161431 12:118732525-118732547 TGGCATGAGCAGGGCAGGAGAGG + Intergenic
1103928506 12:124436666-124436688 TGCTCTGATTAGGCCAGGAGAGG - Intronic
1103942862 12:124510368-124510390 TGCCCTGAGCAGCCACGGGAGGG + Intronic
1104001629 12:124863964-124863986 GGGCCTGAGCGGGCCCGGGGCGG + Intronic
1104558343 12:129822197-129822219 GGCACTGAGCAGGGCTGGAGGGG + Intronic
1104569137 12:129909684-129909706 TGCCCTGTGCTGGGCCGGTGGGG + Intergenic
1104895705 12:132162643-132162665 TGCCGTGAGGAGGCTCGGGGAGG + Intergenic
1107313948 13:39110897-39110919 TGCCCTGAGCAGGAGTGGAGAGG - Intergenic
1107800575 13:44104512-44104534 TTCCCTGGGCAGGCAAGGAGAGG - Intergenic
1112816772 13:103281902-103281924 TGCCCTGAGCAGGCAGGGGTAGG + Intergenic
1113134396 13:107073666-107073688 TGTCCTGAGCAGTCGGGGAGGGG + Intergenic
1113861602 13:113490799-113490821 GGCGCTGAGCATGCCGGGAGTGG - Exonic
1113890690 13:113734271-113734293 TGCCCTGGGCAGGCCCAGCGAGG + Intronic
1118199161 14:63656227-63656249 TGCCCTGAGCATTCTCGCAGGGG - Intergenic
1118787729 14:69060097-69060119 TGACGTCAACAGGCCCGGAGAGG + Intronic
1122071573 14:99208658-99208680 TGCCCCGAGCCTGCCCGGACAGG - Intronic
1122582205 14:102777783-102777805 TGCCCGGCGCGGGCCCGGCGCGG + Intronic
1122767564 14:104082482-104082504 TGGCCAGAGCAGCCACGGAGTGG - Intergenic
1122885841 14:104709929-104709951 TGCTCTGCGCAGGCCCGGGAGGG + Intronic
1122890510 14:104730039-104730061 TGGGCTGAGCTGGCACGGAGTGG - Exonic
1123036794 14:105474918-105474940 TGCACCGAGCGGGCCGGGAGCGG - Intronic
1123737137 15:23196222-23196244 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124288353 15:28424887-28424909 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124294871 15:28492427-28492449 TACCCTGTGCAGGCCGGGCGCGG + Intergenic
1124512138 15:30336505-30336527 TGACCTGAGCAGGCTCTGGGAGG - Intergenic
1124730776 15:32194246-32194268 TGACCTGAGCAGGCTCTGGGAGG + Intergenic
1126731578 15:51688851-51688873 TGCCCTGACCTGGCCCTGACAGG + Intronic
1128245145 15:66127843-66127865 TGCCCTGAGGAGGACGGGTGAGG - Intronic
1130660249 15:85825803-85825825 AGCCATGAGCAGGGCAGGAGAGG - Intergenic
1132394014 15:101459235-101459257 TTCCCTGTGCAGGCACGTAGGGG - Intronic
1132661814 16:1064989-1065011 TGCACAGAGCAGGCCCTGTGAGG - Intergenic
1132709776 16:1261283-1261305 TGCCCTGAGCAGGCTGGGCTGGG - Intergenic
1132745467 16:1434476-1434498 GGCCCTGCGGAGGCCAGGAGGGG - Exonic
1133096084 16:3446899-3446921 TGCAGTGAGCAGGCCAGGTGCGG - Intronic
1134071264 16:11261306-11261328 TGCCCTGAACAGGCTCAGGGAGG + Intronic
1134315362 16:13113882-13113904 TGCCCTGAGCTGGCTGGCAGGGG + Intronic
1136170448 16:28486318-28486340 TGCCCTGAGCCGGGAGGGAGAGG - Intronic
1136411575 16:30080831-30080853 TGCCCAGGGCAGGCCCACAGTGG - Intronic
1137490168 16:48925832-48925854 TGGCCTGAGCTGGCCCTGAAAGG + Intergenic
1138377647 16:56577096-56577118 TGGCCTGAGCAGGTGCAGAGTGG - Intergenic
1139728633 16:68923246-68923268 TGACCTAAGCAGGCCAGGCGCGG - Intronic
1140934598 16:79658679-79658701 TGCACTGAGCTGGCCAGGATAGG - Intergenic
1142262056 16:89047717-89047739 AGCTCTGAGCAGCCCAGGAGTGG + Intergenic
1142425013 16:89997528-89997550 TGTCCTGAGGAGGCCCGGGAAGG - Intergenic
1142434884 16:90050049-90050071 TACCCTGAAGAGGCCAGGAGAGG - Intergenic
1144515977 17:15917770-15917792 TGCCCGCGCCAGGCCCGGAGCGG - Intergenic
1144833590 17:18144977-18144999 AGCCCTGGGCAGGGCCAGAGAGG + Intronic
1145013905 17:19384754-19384776 AGCCCCGAGCTGGCCGGGAGAGG + Intronic
1146581137 17:34039957-34039979 CCCCCTGGGCAGGCCCGGGGCGG + Intronic
1147258282 17:39194967-39194989 TGCCCTGAAGAGGCCAGGAAAGG + Exonic
1147318600 17:39632848-39632870 TCCCCTCAGAAGGCCCAGAGGGG - Intronic
1147884483 17:43675591-43675613 TGGCCTGGGCAGGCCCAGGGAGG + Intergenic
1147972532 17:44227119-44227141 AGCCCTGCCTAGGCCCGGAGTGG - Intergenic
1149539571 17:57458826-57458848 TGCCCTGTGCAGGCCGTGGGAGG + Intronic
1149624181 17:58067931-58067953 TGGCCTGTCCAGGCCTGGAGAGG + Intergenic
1150108628 17:62479189-62479211 CCCCCTGGGCAGGCCCGGGGCGG - Exonic
1152313203 17:79563407-79563429 TGCCCTCAGCAGCCCCTTAGGGG + Intergenic
1152424674 17:80212466-80212488 TTCCCTGAGCAGGCCTCGAATGG + Intronic
1152460464 17:80439538-80439560 TTCCCTGGCCAGGCCCCGAGTGG + Intergenic
1152866852 17:82729255-82729277 TGTCATGAGCTGGGCCGGAGGGG + Intronic
1153539604 18:6139804-6139826 GGCCCTGAGGAGGCACAGAGAGG - Intronic
1158298987 18:56031469-56031491 TGCCCTCATCAGGCCAGGAATGG + Intergenic
1159305598 18:66638249-66638271 TGCCCTGTGCAGTCCCAAAGGGG + Intergenic
1159916677 18:74194192-74194214 TGGCCTGAGGAGTCCTGGAGAGG + Intergenic
1161267169 19:3369719-3369741 GGCCCAGAGCAGGCGCGGGGAGG - Intronic
1161403672 19:4080429-4080451 CGCCCTGCGGAGGCCCAGAGAGG + Intergenic
1161440833 19:4290782-4290804 AGCCCTAAGCAGCCCTGGAGAGG + Intergenic
1161720160 19:5897932-5897954 TGCCCTGAGCAGTCAGGCAGAGG - Intronic
1162412216 19:10513365-10513387 TGCCTGGAGCAGGGACGGAGGGG - Exonic
1163063649 19:14777188-14777210 TTCCCTGGGCAGGCACGCAGGGG + Intronic
1163156439 19:15442438-15442460 TGCCAGGAGCAGGGCCAGAGGGG - Intronic
1163831391 19:19548674-19548696 TGCCCTGAGCTGACCCAGGGTGG - Intergenic
1165864203 19:38926172-38926194 TGCCCTGAGTAGGTGGGGAGTGG - Intronic
1165901929 19:39173250-39173272 TGCCGACATCAGGCCCGGAGAGG - Exonic
1166119391 19:40676470-40676492 AGCCCTGAGAAGGCCAGGCGCGG + Intronic
1166672324 19:44718569-44718591 TGTCCCGAGCAGGTCCGCAGTGG + Intergenic
1167371740 19:49086567-49086589 TTCACTGAGCAGGCCAGGAATGG + Intronic
925034393 2:674561-674583 TGCCCTGAGGAGTGCTGGAGTGG - Intronic
926983918 2:18600244-18600266 TTACCTGAGCAGGACTGGAGAGG + Intergenic
928053052 2:28021368-28021390 TGCCGTGTGCAGGCCCTGTGTGG + Intronic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
929170368 2:38926495-38926517 AGCCCTGACCAGCCCGGGAGGGG - Intronic
929533024 2:42764109-42764131 TGCCCTGAGCACTCCTGCAGGGG - Exonic
929578041 2:43064911-43064933 TGCTCTGCTCAGGCCAGGAGTGG + Intergenic
934534461 2:95121685-95121707 GGCTCTGAGCGGGCCGGGAGTGG - Intronic
934664853 2:96163229-96163251 AGCCCTGAGCAGGCCAAGGGGGG + Intergenic
935261520 2:101359648-101359670 AGACATGAGCAGGCCAGGAGAGG - Intronic
936550776 2:113437767-113437789 GGCCCCGGGCAGGCCGGGAGTGG + Exonic
937960733 2:127456022-127456044 TGCTGTGAGCAGGCACTGAGTGG + Intronic
938976794 2:136486455-136486477 AGCCCTTAGCAGGCCGGGTGCGG + Intergenic
939564431 2:143770234-143770256 TGCCCTTAGCAGGCAGGGACAGG - Intergenic
945269507 2:207924392-207924414 TGCCCTGATAAGGCCAGGTGTGG + Intronic
946037632 2:216756449-216756471 AGTGCTGAGCAGGCCCGGTGTGG + Intergenic
947353656 2:229271373-229271395 CGCTCTGAGCATGCCCGGGGCGG + Intergenic
947363025 2:229365319-229365341 TGACCTGGGCAGGCCCGTAGAGG - Intronic
1168746975 20:252047-252069 AGGCCTGAGCAGGGCAGGAGAGG + Intergenic
1168866418 20:1090747-1090769 TCCTCTGATCAGGCCCAGAGAGG + Intergenic
1169088125 20:2839999-2840021 AGCATTGAGCAGCCCCGGAGGGG - Intronic
1172275361 20:33676256-33676278 TGCTCTGACCAGGCCAGGTGGGG - Exonic
1174182470 20:48683417-48683439 GGCCCTGATGAGGCCCAGAGAGG - Intronic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175312247 20:58019957-58019979 TGCCCTAACCAGGCTCTGAGGGG + Intergenic
1175442547 20:59001840-59001862 TGCCCAAAGAAGGCCAGGAGAGG - Intronic
1175631153 20:60537405-60537427 TGGTCTGAGCAGGGCAGGAGAGG - Intergenic
1175977008 20:62715899-62715921 TGGGCTGAGCAGGGCCCGAGAGG + Intronic
1176868583 21:14070482-14070504 TGTCCTGAGCAGGCGCGATGTGG + Intergenic
1178479481 21:32967254-32967276 AGACATGAGCAGGCCAGGAGGGG + Intergenic
1179959453 21:44759802-44759824 TGCCCTGAGCTGGCCGTGGGGGG - Intergenic
1180172256 21:46065715-46065737 TGGCCTGAGCGGGACAGGAGGGG - Intergenic
1181572255 22:23773920-23773942 TGCCCTGAGCAGAGCCAGAGTGG - Intronic
1182104894 22:27682248-27682270 TGCCCAGAACAGGCCAGAAGTGG + Intergenic
1182550812 22:31099966-31099988 TGCCCTGAGAACCCCTGGAGCGG + Intronic
1183096812 22:35557081-35557103 GGCTCTGAGCAGGCCGGGTGAGG + Intergenic
1184197898 22:42944133-42944155 TCCACTGAGCAGGCCTCGAGTGG + Intronic
1184523248 22:45007892-45007914 TCCCCGGAGGGGGCCCGGAGGGG + Intronic
1184549468 22:45196832-45196854 TGCCCAGAGCGGGGCCAGAGCGG - Exonic
1184749024 22:46473570-46473592 TGCCCTAACCAGGCCTCGAGGGG - Intronic
1185373970 22:50473837-50473859 TGGCCTGAGCCGGCTCAGAGAGG - Intronic
950657383 3:14444989-14445011 TGCCCTGGGCAGGCCTGGGGAGG + Intronic
952815512 3:37443854-37443876 TGCCCTGTGAAGGGCTGGAGAGG - Intergenic
953743662 3:45557149-45557171 GCCCCTGCGAAGGCCCGGAGGGG - Intronic
953748818 3:45594548-45594570 TCCGCTGAGCAGGCCCGGGACGG + Intronic
954145602 3:48632885-48632907 GGCACTGAGCAGGGCAGGAGCGG - Intronic
954374827 3:50188733-50188755 TGCCCTGGCCAGGCGGGGAGGGG - Exonic
954379516 3:50212283-50212305 TGCCCTGGGCAGGCTGGGACAGG - Intronic
956368433 3:68531828-68531850 TGACATGAGCAGGGCAGGAGAGG - Intronic
956643002 3:71432329-71432351 TGCTCTGTGCAGGGCCGGGGAGG - Intronic
957865040 3:86012508-86012530 TGCCCTGAGGAGGCCGGGAGCGG + Intronic
961393490 3:126570398-126570420 TGCCCTCTGCAGGCCAGGATGGG - Intergenic
961698712 3:128725309-128725331 AGACCTGAGCAGGGCAGGAGAGG - Intergenic
962400762 3:135057007-135057029 TTCACTGAGCAGGCCCAGAGGGG - Intronic
962604844 3:137024549-137024571 TGCCATGAGCTGGCCAGAAGAGG - Intergenic
962878344 3:139553215-139553237 TGCCATCAGCAGGCCAGAAGTGG - Intergenic
963458855 3:145579814-145579836 TACCATGAGCAGGGCAGGAGAGG - Intergenic
965268463 3:166580782-166580804 TGTCCTTAGCTGGCCCGGAGGGG + Intergenic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
968750542 4:2386834-2386856 TGGCCTCAGCAGGCGCGCAGCGG - Intronic
968940510 4:3635022-3635044 GGCCATGAGCAGGGCCGGGGAGG + Intergenic
969232768 4:5843092-5843114 TGCCCTGAGCAGACCTGAAGAGG - Exonic
969317823 4:6392686-6392708 TGCACCCAGCAGGCCGGGAGAGG + Intronic
972344587 4:38182521-38182543 TGGCCTGTGCCGGCCCAGAGAGG - Intergenic
973635861 4:52861914-52861936 TGCTCTGGGCGGGCCGGGAGCGG - Intergenic
975425880 4:74227042-74227064 TGCCCTGGTCTGGCCCTGAGAGG + Intronic
978515876 4:109567987-109568009 TCCCCTGTTCAGGCCAGGAGCGG - Intronic
982113315 4:152075773-152075795 TTCCCTGAGCAGGGACAGAGTGG - Intergenic
985528700 5:421260-421282 TGCCGTGTGCAGGCACGGAACGG + Intronic
985673089 5:1216383-1216405 TCCCCTGAGCCTGCTCGGAGTGG + Intronic
985963571 5:3322213-3322235 AGCTGTGAGCAGGCCAGGAGTGG + Intergenic
986209585 5:5658355-5658377 AACCCTGAGCAGGCATGGAGTGG + Intergenic
986748468 5:10763895-10763917 CGGCCTGAGCAGGGCAGGAGAGG + Intergenic
987959631 5:24789315-24789337 TTCCCGGAGCAGGCCCTGATGGG + Intergenic
996708110 5:126517645-126517667 TGCCCTTAGCAGGTCAGGCGTGG - Intergenic
997868466 5:137486017-137486039 TGCCCTTAGCAGCCCTGGATTGG - Intronic
998455437 5:142269121-142269143 AGCCCTATGCAGGCCTGGAGCGG - Intergenic
998952794 5:147408727-147408749 TGTACTGAGCAGGCCAGAAGAGG - Exonic
1000616948 5:163437747-163437769 TGAGGTGAGCAGGCCCGGGGAGG + Exonic
1001596521 5:172902281-172902303 TCCCCGTAGGAGGCCCGGAGTGG + Intronic
1002346518 5:178551747-178551769 TGCCCTGAGCACCCCCTCAGGGG + Intronic
1002539188 5:179894642-179894664 TGCCCTGCACAGTCCCGGACAGG + Intronic
1003053210 6:2797960-2797982 TGCCCTGGGCAGGCTGTGAGAGG + Intergenic
1003080148 6:3015258-3015280 GGCCCTGGGCAGGCAGGGAGGGG - Intronic
1005821565 6:29603606-29603628 TCCCCTGGGCAGGCCCCCAGAGG + Exonic
1005994239 6:30921974-30921996 TGCCCTGGGCTGGCCCCAAGAGG + Exonic
1006847429 6:37072313-37072335 TGCCATCAGCAGGCCAGGTGCGG + Intergenic
1006988547 6:38193554-38193576 GGCCCTGAGCAGATCCTGAGAGG + Intronic
1007431562 6:41780075-41780097 GGGGCTGAGCAAGCCCGGAGGGG + Intronic
1007796274 6:44350522-44350544 TGTCCTGAGAAGCCCCAGAGTGG + Intronic
1008579212 6:52890601-52890623 TGCCCTGAGCAGGGGGTGAGTGG - Intronic
1012928201 6:105289215-105289237 TGCCCCGGGAAGGCCTGGAGAGG - Intronic
1015919818 6:138255590-138255612 TGCACTGCGCCGGCCCTGAGCGG + Exonic
1015996981 6:139005266-139005288 TGTCCTGCACAGGCCTGGAGTGG + Intergenic
1017779916 6:157707862-157707884 AGGCCTGAGCAGGGCAGGAGAGG - Intronic
1018374997 6:163202064-163202086 GGACCTGAGCAGGCCCGTTGGGG + Intronic
1018950340 6:168374749-168374771 TGCCCTGGGCAGCCGTGGAGTGG - Intergenic
1019390475 7:783917-783939 TGCCCTGTGCAGTCCTGGGGAGG - Intronic
1020268243 7:6576262-6576284 AGCCCTGAGAAGGCCCTGTGGGG - Intergenic
1023041918 7:36179964-36179986 TGCCCTGAGTGGGGCCGGGGTGG + Intronic
1025089672 7:56051790-56051812 TGCCCAGAGCCGGCGCGGCGTGG - Exonic
1025149468 7:56537621-56537643 TGCACTGAGCACGTCCGAAGGGG + Intergenic
1025976681 7:66376402-66376424 TGCCCGGCGTAGGCCCTGAGGGG - Intronic
1028988140 7:97023773-97023795 TGCCCTGAGCACGCTGGGTGGGG - Intronic
1029450346 7:100638319-100638341 AGCCCTGAGCAGGCTGGGTGCGG + Intronic
1032037647 7:128531705-128531727 CCCCCTGGGCAGGCCCGGGGCGG - Intergenic
1034184448 7:149163814-149163836 TACCCTGACCAGGCTGGGAGTGG + Intronic
1035581926 8:745975-745997 TGGCCTGAGCAGGCCGTGAGGGG - Intergenic
1036564640 8:9928075-9928097 ATCCCTGAGCAGGCCGGGCGTGG - Intergenic
1037572465 8:20170089-20170111 TGCCCTGAGGAGTCCTGGATGGG + Intronic
1037766488 8:21775476-21775498 GGCTCTGAGGTGGCCCGGAGAGG + Intronic
1037967352 8:23145105-23145127 TCTCCTGAGCAGGCGGGGAGGGG + Intronic
1041192029 8:55364393-55364415 TGGCCTGAGCAGAGCTGGAGAGG - Intronic
1043303344 8:78762462-78762484 TGCCCTGAGGAGGCGGGGAGGGG - Intronic
1048970488 8:139642727-139642749 TGACCTGAGCAGGCCCTGTGGGG - Intronic
1049060131 8:140270253-140270275 TGCACAGAGCAGGCGTGGAGAGG + Intronic
1049098628 8:140563689-140563711 GGCCCTGGGCAGGCTAGGAGAGG - Intronic
1049531699 8:143158563-143158585 GGCCCCGAGCTGACCCGGAGGGG - Intronic
1049618372 8:143586539-143586561 GGCCCTGAGCAGACCCGGCCCGG + Intronic
1049902157 9:179049-179071 GGCCCCGGGCAGGCCGGGAGTGG - Exonic
1056557611 9:87702960-87702982 TGCCCTGAGCAGAGCCACAGTGG - Intronic
1058813804 9:108665754-108665776 TGCCCTGAGCAGCCCTGCTGTGG - Intergenic
1058875916 9:109244705-109244727 TGCCCTCTGCAGGCCAGAAGTGG - Intronic
1059387335 9:113974779-113974801 GGCCCTTAGCAGGGCTGGAGAGG - Intronic
1060103603 9:120860171-120860193 TGGCCTGAGCTGGCACTGAGAGG + Exonic
1060552662 9:124492918-124492940 TGCCCAGAGCCAGCCCCGAGAGG + Intronic
1060662527 9:125412889-125412911 GGCCCAGAGCAGGCAAGGAGGGG - Intergenic
1061036167 9:128115495-128115517 TGACCTGGGCTGGCCAGGAGCGG + Intergenic
1061627826 9:131851925-131851947 TGCCCTGGGAAGGGCAGGAGAGG - Intergenic
1062032491 9:134367980-134368002 TACTCTGAGCAGGCAGGGAGCGG - Intronic
1062166347 9:135109515-135109537 TGCTCTGAGCAGGCTCCGGGTGG - Intronic
1062280063 9:135747807-135747829 AGCCCTGAGTATGCCCGGTGGGG + Intronic
1062450075 9:136611479-136611501 TGCCCAGGGCAGGCCCAGTGTGG + Intergenic
1062452229 9:136620592-136620614 TGCCCTGGGCAGACATGGAGCGG - Intergenic
1062537077 9:137025736-137025758 TGCCCATAGCAGGCCGGGTGTGG - Intronic
1189261196 X:39679928-39679950 TGCCTTGGGCAGGCCAGGAGAGG + Intergenic
1190059721 X:47202934-47202956 TTCCCGGAGCAGGCCTGGAGAGG - Exonic
1192792782 X:74399584-74399606 TGCCCTGAAGAGGCGGGGAGGGG - Intergenic
1198184093 X:134237221-134237243 AGCCCGGAGCCGGCCCGGCGGGG + Exonic
1198215504 X:134550827-134550849 AGCCCTGGGCAGGCCAGGAGGGG + Intergenic
1199996116 X:153027952-153027974 TGCCCTGTGCAGTCCCAGATGGG + Intergenic
1200258946 X:154601400-154601422 TCCCCTGAGCACCCCTGGAGAGG - Intergenic