ID: 1078443538

View in Genome Browser
Species Human (GRCh38)
Location 11:11387098-11387120
Sequence GCATTTACATCCTTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078443538_1078443540 10 Left 1078443538 11:11387098-11387120 CCATAACACAAGGATGTAAATGC 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1078443540 11:11387131-11387153 CGGCTGCCTCACACCTGCCCAGG 0: 1
1: 0
2: 4
3: 34
4: 282
1078443538_1078443539 -10 Left 1078443538 11:11387098-11387120 CCATAACACAAGGATGTAAATGC 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1078443539 11:11387111-11387133 ATGTAAATGCAGTCTGAAAACGG 0: 1
1: 0
2: 1
3: 23
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078443538 Original CRISPR GCATTTACATCCTTGTGTTA TGG (reversed) Intronic
900689874 1:3974030-3974052 GCCTTTTCACCCTTGTTTTAAGG - Intergenic
900855203 1:5175982-5176004 GCATTTACATACTTGTGACTTGG - Intergenic
901126113 1:6929992-6930014 GCATTTACAGCCTGGTGTAGGGG - Intronic
901126123 1:6930044-6930066 GCATTTACAGCCTGGTGCAAAGG - Intronic
902683726 1:18061953-18061975 GCACTCAAATCCTTGTCTTAGGG + Intergenic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905450495 1:38053059-38053081 CCATTTATGTGCTTGTGTTAGGG + Intergenic
907207528 1:52786670-52786692 GCATTTAAATCCATATGTTGAGG + Intronic
907496081 1:54845683-54845705 GCATTCAAATCTTTGTCTTAGGG + Intergenic
913557980 1:119988160-119988182 GCATTTACAGCCTTGTGAGTGGG + Intronic
919410220 1:197233440-197233462 TCATTTACATCCTTGAGATCAGG - Intergenic
924121842 1:240808203-240808225 TCATGTACTTCCTGGTGTTACGG - Intronic
924166338 1:241287221-241287243 ACATTTAAATCCCTGTGATATGG + Intronic
1065305452 10:24364325-24364347 GCATTTACAAGCTTGATTTACGG - Intronic
1068889169 10:62131009-62131031 GCACTTAAATGCTTGTCTTAGGG - Intergenic
1069097008 10:64271262-64271284 GCATTCACAACCTCGTCTTATGG - Intergenic
1069842548 10:71348812-71348834 GCATTTGAATCCTTGTTTCAGGG - Intronic
1071881682 10:89905722-89905744 GCATGTAAATCCTTGTTTCAGGG + Intergenic
1072095399 10:92173539-92173561 GAATTTGCATGTTTGTGTTAAGG + Intronic
1072605796 10:96981678-96981700 CCATTTACATCCCAGTGATAAGG + Exonic
1074873198 10:117594240-117594262 GTATTTTCATCCTGGTTTTATGG + Intergenic
1077621820 11:3731712-3731734 GTGTTAACATCCTTGTTTTATGG - Intronic
1078443538 11:11387098-11387120 GCATTTACATCCTTGTGTTATGG - Intronic
1078760278 11:14245906-14245928 GAATTCACATCCTTGTTTTTTGG - Intronic
1079213762 11:18487487-18487509 GTTTTTTCTTCCTTGTGTTAAGG - Intronic
1080879937 11:36310451-36310473 GCATTTGTATCCTTGTCTCAGGG - Intronic
1080967542 11:37231017-37231039 GCCTTTTCATCCTGATGTTAAGG + Intergenic
1081352612 11:42072845-42072867 GCACTTGAATCCTTGTCTTAGGG + Intergenic
1082189528 11:49225947-49225969 GCATTCACATCCTTATGTCCTGG - Intergenic
1085733754 11:79021367-79021389 GCATTTGAATCCTTTTTTTAGGG - Intronic
1086950493 11:92885762-92885784 TCATTTCCTTCCTTGTGTTCAGG + Intronic
1088348641 11:108859653-108859675 ACATTTATATGCTTGAGTTAGGG + Intronic
1089707098 11:120286305-120286327 GCCTTTACATGCATGTGTTTTGG + Intronic
1094247307 12:28313670-28313692 GTATTTATTTCCTTTTGTTATGG - Intronic
1098754969 12:74350931-74350953 GCAATTACATGCATGTGTTCTGG + Intergenic
1100008321 12:89921425-89921447 GCATATAAATCCTTGTCTCAGGG + Intergenic
1101370796 12:104128300-104128322 AAATTTACAATCTTGTGTTACGG - Intronic
1101919555 12:108921379-108921401 GCACTTGCATCCTTGTCTCAGGG - Intronic
1104250229 12:127086297-127086319 GCATTTGCATCTTTGTCTTCTGG - Intergenic
1105758288 13:23489825-23489847 CCATTTCCATTCTTGTCTTAGGG - Intergenic
1106775126 13:33001566-33001588 GCTTCTACATCCTTCTCTTAAGG + Intergenic
1107227912 13:38072998-38073020 GCATTTTCATACATGTGTTGAGG + Intergenic
1108740852 13:53336945-53336967 TCATTTATATTCTTCTGTTATGG + Intergenic
1110018916 13:70443753-70443775 GCATTAACATCCTGGTGTGGAGG + Intergenic
1114702563 14:24693810-24693832 GCCTTCCCACCCTTGTGTTAAGG + Intergenic
1115449535 14:33530559-33530581 GCTTTCACATCCATGTGTCAAGG - Intronic
1117093683 14:52275075-52275097 ACATATACATGCTTTTGTTATGG - Exonic
1121760092 14:96437442-96437464 GAATTTCCATCCTTGTGTTAAGG + Intronic
1121818234 14:96944395-96944417 TCTTTTGCAGCCTTGTGTTATGG - Intergenic
1121831355 14:97054994-97055016 GCATTGACAGCCTTTTGCTAGGG + Intergenic
1126257615 15:46646223-46646245 GCATTACCTTCCTAGTGTTATGG + Intergenic
1128657703 15:69474614-69474636 AAATTTATATCCTTGTCTTAGGG - Intergenic
1130008113 15:80122387-80122409 TCATTTACAGCTTTGTCTTAGGG + Intronic
1133577445 16:7107277-7107299 GCATTTACATCCCTGAATAAAGG - Intronic
1134106773 16:11491262-11491284 GAATTTACATCTTTGCGTTCAGG + Intronic
1134257580 16:12624864-12624886 GCATTTTCAGCCTGGTGTAATGG - Intergenic
1134368683 16:13603475-13603497 ACATTTATATCCTTGTGCAAAGG - Intergenic
1137688237 16:50401832-50401854 GCCCTCACATCCTTGTGTGAGGG + Intergenic
1137831678 16:51549626-51549648 GGATTTTCATCCTGGTGTTCTGG + Intergenic
1139122112 16:64033128-64033150 GAATTTACATCCTTGAGGTTAGG - Intergenic
1140130001 16:72152133-72152155 GAATTTATATCCTTGTCTTAGGG + Intronic
1141020907 16:80495645-80495667 TCATTTCCATCCTGGTGTTCAGG - Intergenic
1141191979 16:81831669-81831691 GGACTCAGATCCTTGTGTTAGGG + Intronic
1149188051 17:54024934-54024956 CCTTTTACATATTTGTGTTATGG - Intergenic
1152096380 17:78274292-78274314 GCATTCACATCCTTGACTTGGGG - Intergenic
1153225417 18:2896100-2896122 TCTTTTATATCCTTCTGTTAAGG + Intronic
1153756805 18:8292324-8292346 GCTTTTATTTCCTTTTGTTATGG - Intronic
1154228525 18:12531274-12531296 GCATGCACATGCTGGTGTTAGGG - Intronic
1155342248 18:24824630-24824652 ACAATCACATCCTTCTGTTAAGG + Intergenic
1159572514 18:70134058-70134080 GCATGCACATCCTTAAGTTAAGG - Intronic
1163328891 19:16623336-16623358 GCATTTACATGTTTGGGTTTAGG + Intronic
1166157334 19:40923703-40923725 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166166193 19:40990728-40990750 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166242708 19:41505076-41505098 GCATATACACCCCTGTGATATGG - Intergenic
927407204 2:22784611-22784633 TAATTTACATCCTTGGTTTAGGG - Intergenic
927944716 2:27128690-27128712 TCATCTACATCCCTGTGTTGAGG + Intronic
930272667 2:49275121-49275143 CCATTTACATCTTGGTGTTCTGG - Intergenic
932454809 2:71842658-71842680 TCACTTACATCCTTGTCTCAGGG + Intergenic
939567022 2:143797239-143797261 GGATCTTCATCCATGTGTTAAGG - Intergenic
939849704 2:147289974-147289996 GCAATTATATCCTTGTCTTATGG + Intergenic
940577070 2:155522529-155522551 GGATTTACAGACTTGTATTAGGG - Intergenic
940835755 2:158519603-158519625 GCCTTTGCCTCTTTGTGTTATGG + Intronic
941414775 2:165206345-165206367 ATATTTAAATTCTTGTGTTAGGG - Intergenic
942685742 2:178530093-178530115 ATATTTACCTCCTTGTGTAATGG + Exonic
947470738 2:230399237-230399259 GTATTTGCATCCATGTGTTGTGG - Intronic
1169834830 20:9866463-9866485 GCATTTAAATCTTTGTCTCAAGG - Intergenic
1170077460 20:12435249-12435271 GCATTCAAATCCTTGTGATATGG - Intergenic
1170798665 20:19571940-19571962 ACATTTAAATCCTTGTCTCAAGG - Intronic
1170827792 20:19811137-19811159 GCATCTAAATCCTTGTCTCAGGG - Intergenic
1170974518 20:21149887-21149909 ACACTCAAATCCTTGTGTTAGGG - Intronic
1173071517 20:39772983-39773005 GCACTTAAATCCTTGTCTCAAGG - Intergenic
1173152036 20:40575517-40575539 ACATTTACATTGTTGTGTAATGG - Intergenic
1173465974 20:43281688-43281710 GCATTCCCACCCTTGTCTTAAGG + Intergenic
1179413507 21:41179834-41179856 ACACTTACATCCATGTGTCAGGG - Intronic
1184604692 22:45565538-45565560 GCATTTACCCCATTGTGTTGTGG + Intronic
1185134432 22:49061257-49061279 TCAATTACGTCCTTGTGTCAGGG - Intergenic
951096080 3:18632935-18632957 GAATTCACATCCCTGTGCTAAGG - Intergenic
951704611 3:25530962-25530984 GCATTCAAATCCTTGTCTTAGGG - Intronic
951867912 3:27328111-27328133 GCATTTATATCCTGATTTTAGGG - Intronic
952588504 3:34922538-34922560 GCATTTATCTCCTTGTGTACTGG - Intergenic
952645687 3:35655690-35655712 ACATTTACTTCCTTCTGTAATGG - Intronic
952821013 3:37485486-37485508 GCATTTACCGCTTTGGGTTATGG + Intronic
953238631 3:41127923-41127945 GCATTTGAATCCTTGTCTCAAGG - Intergenic
957219649 3:77365311-77365333 ATTTGTACATCCTTGTGTTAAGG + Intronic
957843946 3:85706325-85706347 GAAATCACATCCTTGTGTTCTGG - Intronic
958816134 3:98918003-98918025 GTCTTTTCATCCTTGTATTAGGG + Intergenic
959620701 3:108396026-108396048 GAATTTACATTTTTGTGTTAGGG + Intronic
961980617 3:131074162-131074184 GCATTCAAATCCTTGTCTCAGGG + Intronic
962467614 3:135674857-135674879 CCACTCACATCCTTGTCTTAGGG - Intergenic
963156299 3:142100717-142100739 GCATTTCCATCTATATGTTAGGG - Intronic
970733453 4:19136918-19136940 GCATCTACAGCCTGGAGTTATGG - Intergenic
971075282 4:23140919-23140941 GCATTTTCATCTTTTTGCTAAGG - Intergenic
971130264 4:23801115-23801137 GCATTGCCATCATTGTTTTATGG - Intronic
971485481 4:27156022-27156044 ACATATGAATCCTTGTGTTAGGG + Intergenic
971731384 4:30386692-30386714 GCAATTTCATCCTTGTGCAAAGG - Intergenic
971978592 4:33723967-33723989 GCAATTACCTCCTTTTGTTCAGG - Intergenic
972128861 4:35803463-35803485 ACATTTATATCATTGTGTTATGG - Intergenic
972719462 4:41681580-41681602 GCCTTTACCTCCTTGGCTTAAGG - Intronic
981857620 4:149313020-149313042 GCATTTAAATCTTTATTTTAGGG + Intergenic
982831160 4:160062384-160062406 CCATTTTCATCCTTATGATATGG - Intergenic
987542194 5:19270353-19270375 GCTTTTACATCCTGTTGTCATGG - Intergenic
988607066 5:32687870-32687892 GCATCTAAATCTTTGTATTAAGG + Intergenic
990615803 5:57507159-57507181 GCATTTACATGCTTGTGAGAAGG + Intergenic
990958153 5:61364303-61364325 GCATATACATGCTTGAATTAGGG + Intronic
991644624 5:68789364-68789386 GCATTTACCTGCTTTTGTGATGG + Intergenic
993369040 5:87069647-87069669 GCATTAACACCCTGATGTTAAGG - Intergenic
995023837 5:107396887-107396909 GGATTTACATCCTTGTCCTACGG - Intronic
995165283 5:109032483-109032505 GCATTTGAATCCTTGTCTCAGGG + Intronic
995766097 5:115621373-115621395 TCATTTACAACCTTGTTTTGAGG + Intronic
1001425693 5:171620801-171620823 GCATTTGCGTCCTTGTTTCAAGG - Intergenic
1004895458 6:20143511-20143533 GCTTTTCTATCCCTGTGTTAGGG - Intronic
1005816141 6:29554195-29554217 GTATTTCCATCCTTGGGTTCTGG - Intergenic
1009047375 6:58247577-58247599 GGGTGTACATCCTTGTGATATGG + Intergenic
1010855927 6:80839218-80839240 TCATTCACATCCTTGTTTTGTGG + Intergenic
1010962983 6:82168216-82168238 GCACTTACCTCTTTATGTTATGG + Intergenic
1011863832 6:91795342-91795364 GCATTTAAATCCTTCTGAAAGGG - Intergenic
1012113904 6:95269423-95269445 TTATTTACATCATTGTATTATGG - Intergenic
1012670068 6:102033061-102033083 TCATTAACATCATTGTGTTTTGG + Intronic
1015084380 6:129271097-129271119 GTATTTATATCCTTTTATTAAGG - Intronic
1017934611 6:158994055-158994077 CCATTTACCTCCTTATTTTATGG - Intronic
1018378274 6:163233654-163233676 GCAGTGACTTCTTTGTGTTAGGG + Intronic
1018410078 6:163535990-163536012 GCATTTACATAAATGAGTTATGG + Intronic
1020494789 7:8836152-8836174 GCATTTACATATTAGTGTAATGG - Intergenic
1020826176 7:13031921-13031943 GCATTGATATCCTTGAGTTATGG + Intergenic
1022582752 7:31572573-31572595 GCAGTTACATACATGTTTTATGG - Intronic
1024831873 7:53469900-53469922 GCAATTGCATCCTTGTTTCAAGG + Intergenic
1025064393 7:55840706-55840728 GCATTTGCATCAGTGTGTTAGGG - Intronic
1025154681 7:56593799-56593821 ACATCTACATCTCTGTGTTAAGG + Intergenic
1028010895 7:85642294-85642316 TTATTAACATCCTTGTTTTATGG - Intergenic
1031334016 7:120503422-120503444 GCATTTACCTCCTTGTTTCTTGG - Intronic
1032371925 7:131364516-131364538 GTTTTTACATAGTTGTGTTATGG + Intronic
1032913831 7:136464294-136464316 GCATTTGCTCCCTTGTGTTCAGG - Intergenic
1033219520 7:139519057-139519079 GCACTTAAATCCTTGTGTCAGGG - Intergenic
1034695951 7:153053836-153053858 GCATATACATGCTTATGTTGGGG - Intergenic
1039261634 8:35777952-35777974 GTATTTTCATTCTTGTGTTTGGG + Intronic
1039261884 8:35780682-35780704 GTATTTTCATTCTTGTGTTTGGG + Intronic
1040596887 8:48847091-48847113 GAACTTAAATCCTTGTCTTAAGG + Intergenic
1041115708 8:54534251-54534273 GCATGTACATAATTTTGTTATGG - Intergenic
1042136151 8:65634836-65634858 GGATTTATATACTTGTTTTATGG + Intergenic
1043180823 8:77084611-77084633 GCATTTGCATTCATGTGTAAGGG - Intergenic
1045352896 8:101358761-101358783 GCATCTACCTACTTGTGCTATGG - Intergenic
1045647714 8:104315787-104315809 GAGTTTACATTCTTGTGTTTTGG + Intergenic
1046794074 8:118351505-118351527 GCATTTACCTCATTGTGCTGTGG + Intronic
1048049393 8:130803081-130803103 GCATTCAAATCCTTGTCTCAAGG + Intronic
1048583290 8:135748925-135748947 TTATTTACATCCTTATATTATGG - Intergenic
1050076139 9:1866633-1866655 ACATTTACATCCATGTAGTATGG + Intergenic
1052321513 9:27172604-27172626 GGCTTCACATCCTTTTGTTAAGG - Exonic
1054834892 9:69666697-69666719 CCCTTTAGATCCTTGAGTTATGG - Intronic
1058367636 9:104229093-104229115 GCATTTAAATGGTTTTGTTAAGG + Intergenic
1058824288 9:108760909-108760931 GCATTTACTTCCATTTGCTAAGG - Intergenic
1059493499 9:114689852-114689874 TGAGATACATCCTTGTGTTAGGG + Intergenic
1059711649 9:116873143-116873165 TCATTTACATCATTGTGTTTTGG - Intronic
1187222306 X:17340123-17340145 GCACTTGAATCCTTGTGTCAGGG - Intergenic
1187290464 X:17948429-17948451 GCACTTAAATCCTTGTTTCAGGG + Intergenic
1188589100 X:31812932-31812954 GTATTTAAATCCTTGTCTCAGGG - Intronic
1188709950 X:33383818-33383840 GCATATTCATCCTTTTGTTACGG + Intergenic
1189263729 X:39697585-39697607 GCATTTAAATCCTTGTCTCAGGG + Intergenic
1189384016 X:40521887-40521909 GCACCTACATCCTTGTCTCAGGG + Intergenic
1189566268 X:42244554-42244576 GCATTTGCATCTTTGTTTAAAGG - Intergenic
1190079165 X:47341952-47341974 GTATTACCTTCCTTGTGTTATGG + Intergenic
1190445852 X:50523389-50523411 TCATTAACTACCTTGTGTTATGG - Intergenic
1196144815 X:112305070-112305092 GCATGTAGATTCTTATGTTATGG - Intergenic
1197538710 X:127726555-127726577 GCATTTTCTTCCATGTTTTATGG + Intergenic
1202015547 Y:20402387-20402409 ACATTTACCTCATTGTGTTGGGG + Intergenic