ID: 1078445628

View in Genome Browser
Species Human (GRCh38)
Location 11:11403016-11403038
Sequence AGCGTCATTCCTTCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078445628_1078445634 15 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445634 11:11403054-11403076 GGAGATGAGAGGACACAGACAGG 0: 1
1: 0
2: 2
3: 61
4: 509
1078445628_1078445633 4 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445633 11:11403043-11403065 CATGATGTGGAGGAGATGAGAGG 0: 1
1: 1
2: 1
3: 37
4: 481
1078445628_1078445637 28 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445637 11:11403067-11403089 CACAGACAGGGAACAAATCAGGG 0: 1
1: 0
2: 1
3: 30
4: 300
1078445628_1078445636 27 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445636 11:11403066-11403088 ACACAGACAGGGAACAAATCAGG 0: 1
1: 0
2: 2
3: 12
4: 251
1078445628_1078445635 16 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445635 11:11403055-11403077 GAGATGAGAGGACACAGACAGGG 0: 1
1: 0
2: 5
3: 67
4: 558
1078445628_1078445638 29 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445638 11:11403068-11403090 ACAGACAGGGAACAAATCAGGGG 0: 1
1: 0
2: 4
3: 63
4: 487
1078445628_1078445630 -9 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445630 11:11403030-11403052 AATGACGCTCCAGCATGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 60
1078445628_1078445631 -6 Left 1078445628 11:11403016-11403038 CCCAGGGCAGAAGGAATGACGCT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1078445631 11:11403033-11403055 GACGCTCCAGCATGATGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078445628 Original CRISPR AGCGTCATTCCTTCTGCCCT GGG (reversed) Intronic
901922400 1:12546781-12546803 AGCCTCATTCTTTCCACCCTGGG + Intergenic
902103055 1:14009760-14009782 AGCATTATGTCTTCTGCCCTGGG + Intergenic
905873061 1:41416040-41416062 AGTATCATTCCCTCTGCCTTCGG + Intergenic
915463766 1:156083998-156084020 AGTGCCATCCCTTCTTCCCTTGG - Intronic
915645450 1:157268759-157268781 AGCGTGATTCTTTCTCCCATGGG + Intergenic
915884343 1:159706684-159706706 ATCTTCATTCCCTCTTCCCTTGG - Intergenic
916289913 1:163154014-163154036 ATAATCCTTCCTTCTGCCCTGGG - Intronic
920179851 1:204125904-204125926 AGCGGCATGCCTGCTGCCCGAGG - Exonic
921092923 1:211860227-211860249 AGCCTCCTTCCTTCTTCCCCTGG - Intergenic
923424950 1:233859518-233859540 AGAGTCATACCTGGTGCCCTTGG + Intergenic
923606902 1:235452453-235452475 ATCCTCATTCTTTCTGCCCATGG + Intronic
1063395414 10:5682981-5683003 AGCTCCACTACTTCTGCCCTTGG + Intergenic
1063810511 10:9699837-9699859 AGTGTCATTTTTTCTGCCCTGGG - Intergenic
1070450068 10:76549130-76549152 AGCCTCATTTCAGCTGCCCTGGG + Intronic
1073631151 10:105150487-105150509 ACTGTCAGTCCTTTTGCCCTGGG + Intronic
1074366828 10:112864648-112864670 AGACTCATTTCTTCTGCCCAAGG + Intergenic
1074896499 10:117781952-117781974 AGTGTCAGTCCTCCTGTCCTGGG + Intergenic
1074936816 10:118190177-118190199 AGGATCATTCCTTTTGGCCTGGG + Intergenic
1075467135 10:122660250-122660272 AGAGCCATTCCTTCTTTCCTTGG + Intergenic
1075931455 10:126300246-126300268 AGCCTCCTTCCTTCTTTCCTGGG - Intronic
1077889915 11:6411411-6411433 AGCATCACTGCTTCTGCCCCAGG + Intronic
1078445628 11:11403016-11403038 AGCGTCATTCCTTCTGCCCTGGG - Intronic
1078663753 11:13307554-13307576 AGACTCATTCTTTATGCCCTTGG - Intronic
1079159777 11:17981126-17981148 TGGGTCACTCCTTCGGCCCTTGG + Intronic
1080725793 11:34898692-34898714 AGCGTCTCTCTCTCTGCCCTTGG + Intronic
1083368912 11:62163075-62163097 AGCATCTTTCATTCTGCCCCGGG + Intergenic
1088888100 11:114023277-114023299 AGCGTCCATCCTTCTGCCTCGGG + Intergenic
1089556926 11:119320174-119320196 TGCCTCCTTCCTCCTGCCCTGGG - Intronic
1094676111 12:32621792-32621814 AGCATCATATATTCTGCCCTTGG - Intronic
1098540987 12:71657586-71657608 AGCATCATTCCTTCTGTGCCAGG + Intronic
1098899916 12:76102020-76102042 TACATCATTCCTTCTGCCCTAGG + Intergenic
1102963158 12:117106839-117106861 AGCATCATTGCTTCAGCCCATGG + Intergenic
1104612682 12:130242513-130242535 GGCATCATTGCTTCTGCTCTTGG + Intergenic
1104775943 12:131390163-131390185 ACCGTCATTCCCTCTGGCCTGGG + Intergenic
1106605346 13:31223729-31223751 TGGGTCATTCCTCCTACCCTGGG - Intronic
1110468718 13:75832905-75832927 AGCTTCATTCTTTCTTCCTTAGG - Intronic
1112586178 13:100720905-100720927 AGAGTAATTCCTTCTGTCCCAGG + Intergenic
1115951590 14:38727846-38727868 AGCCTCAGTCCTGCTGCGCTTGG - Intergenic
1119393109 14:74304618-74304640 GGTGGCATTCCTTCTGACCTAGG + Intronic
1127390904 15:58504292-58504314 GGTGTCATCACTTCTGCCCTGGG - Intronic
1128823124 15:70680573-70680595 AGCCTCATTCCTTCTACCAAAGG + Intronic
1131452951 15:92561366-92561388 AGAGTCAAACATTCTGCCCTTGG + Intergenic
1131652228 15:94412709-94412731 AGCCACATTTCTTCTGCTCTGGG + Intronic
1133236647 16:4390467-4390489 AGCGTCATTCCTGCTAGGCTGGG + Intronic
1139058457 16:63218596-63218618 AGTCTCATTTCTTCTGTCCTTGG - Intergenic
1141066090 16:80915193-80915215 AGCCACAATCCTTCTGCCCATGG - Intergenic
1141625958 16:85261143-85261165 TGGGCCATTTCTTCTGCCCTGGG + Intergenic
1143729979 17:8875915-8875937 AGCAGAATTACTTCTGCCCTAGG - Intergenic
1143812452 17:9483240-9483262 AGCTTCATTCCTTGTACCCTTGG + Intronic
1149494173 17:57106607-57106629 AGCTCTCTTCCTTCTGCCCTTGG - Exonic
1151499793 17:74481440-74481462 AGCATCATTCGTCCTGCTCTGGG - Intronic
1155057811 18:22200507-22200529 GGCTTCATTTCTCCTGCCCTGGG + Intronic
1156473499 18:37391756-37391778 AGTGTCCTGCCATCTGCCCTTGG - Intronic
1163920461 19:20283870-20283892 ATCATCATTCCTTCTTCCTTGGG - Intergenic
1165606456 19:37109196-37109218 ATCGTCATTCCTTCTTCCTCAGG + Intronic
1165868939 19:38957028-38957050 AGCTTCATTCTTTCTGCGGTAGG - Intronic
1167509034 19:49886448-49886470 AGCCTCTGTCCTTGTGCCCTAGG - Intronic
1168191232 19:54740130-54740152 TGGGTCCTTCCTTCAGCCCTGGG + Intronic
1168584853 19:57583991-57584013 AGCATCCTTCCCTCAGCCCTGGG + Intronic
927844646 2:26465142-26465164 AGCCTGATTCCTCCTGCCCTGGG + Intronic
931185018 2:59941394-59941416 AGCATCTTTCCTTCTGTCATAGG - Intergenic
931398818 2:61911815-61911837 AAATTCAGTCCTTCTGCCCTAGG + Intronic
941212455 2:162658070-162658092 ACCCTCATTCCTTCTGCCATGGG + Intronic
942766071 2:179458678-179458700 AGAGTCATTCCTTCTTTTCTTGG - Intronic
946107542 2:217385085-217385107 AGCATCATTCCTCTTGTCCTAGG - Intronic
946114198 2:217447254-217447276 AGCATCTCTCCTTCTCCCCTTGG - Intronic
948626654 2:239273533-239273555 AGCTTCATTCCTTCCTTCCTGGG - Intronic
1173226851 20:41167187-41167209 AGCCTCATCTCATCTGCCCTAGG - Intronic
1173551296 20:43934694-43934716 AGTGTCATGCCCTCTGTCCTGGG + Intronic
1175212072 20:57365931-57365953 ATCTTCATTACTTCTGCCCTTGG - Intronic
1175527119 20:59642763-59642785 ATCTTCATTCCTTCTGCCCCGGG - Intronic
1178447139 21:32655894-32655916 AGAGTCATTCCTTCTAGTCTTGG - Intronic
1180070788 21:45435044-45435066 AGTGGCTTTCCTTCAGCCCTTGG - Intronic
1181287162 22:21761294-21761316 ACACTCATTCCTTCTGCTCTTGG - Exonic
1182160913 22:28120609-28120631 AGCATCATGCCTTCAGCCCAGGG + Intronic
1184277066 22:43414954-43414976 AGGGGCCTTCCTTCTGGCCTGGG + Intronic
951379704 3:21968498-21968520 AGCCTCATTCCTTCTGTCTGAGG + Intronic
951819979 3:26797504-26797526 AGCATCATTCCTGCTGTCATAGG - Intergenic
952667388 3:35922893-35922915 AGCATCTCTCCTTCTGCCCCAGG + Intergenic
953669184 3:44948267-44948289 GTCTTCATCCCTTCTGCCCTGGG - Intronic
954172821 3:48818829-48818851 AGGGTCATTAAGTCTGCCCTCGG - Intronic
958072237 3:88629112-88629134 TGCGACATTCCTTCTGCCTGGGG + Intergenic
958471299 3:94524086-94524108 AGCGTCATTCCCACTGCTTTTGG - Intergenic
961072816 3:123951602-123951624 TGGGTCTTTCCTTCTGCTCTTGG + Intronic
962129260 3:132655241-132655263 GGTGTCCTTGCTTCTGCCCTTGG + Intronic
964384113 3:156129020-156129042 AGCATCATGCCTTCTTCCCGGGG + Intronic
964620671 3:158717517-158717539 AGCTCCAGTCTTTCTGCCCTGGG - Intronic
966245290 3:177801534-177801556 AGAGTGATTAATTCTGCCCTGGG + Intergenic
966447019 3:180012117-180012139 ATCGTAATTCCATCTGCCCCAGG + Intronic
970554814 4:17220619-17220641 AGTGTCATTCATTCTGCAATGGG + Intergenic
971490120 4:27203301-27203323 ACCCTCATCCCTTCTGCCATGGG + Intergenic
982097406 4:151935424-151935446 AGACCCATTTCTTCTGCCCTGGG - Intergenic
982117018 4:152106274-152106296 TGAGTCATTCCTTCTGCCAAGGG + Intergenic
983650602 4:170032706-170032728 AGCCTCATCCCTCCTGGCCTTGG - Intronic
985320146 4:188701818-188701840 AGCGTCCTTCCTTCTGGGGTGGG + Intergenic
985550074 5:528430-528452 CGCGTCCTCCCTTCCGCCCTCGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986416035 5:7529223-7529245 GTCCTCATTCCTGCTGCCCTAGG - Intronic
988453462 5:31366012-31366034 AGAGTCATTCCTCTTGCCCTGGG + Intergenic
990845091 5:60128362-60128384 AAATTCATTCCTTCTTCCCTGGG + Intronic
993643991 5:90440326-90440348 ACCTTCCTTCCTTCTACCCTTGG - Intergenic
994235315 5:97356043-97356065 TGGGGGATTCCTTCTGCCCTTGG + Intergenic
996685410 5:126274584-126274606 AGCTTCATTCCAGCTGCCCCAGG + Intergenic
999013062 5:148064059-148064081 AGTGTCAGTGCTTCTGCCCTTGG + Exonic
1000715432 5:164637885-164637907 AGTGTCATGCCTCCTTCCCTAGG - Intergenic
1002705626 5:181159683-181159705 AGCCTCCCTCCTGCTGCCCTTGG + Intergenic
1003221217 6:4162721-4162743 ATTATCATTCCTTCTGCCCAGGG - Intergenic
1003901288 6:10658267-10658289 AGAGTCATTCATTTTTCCCTGGG - Intergenic
1007090131 6:39179015-39179037 ATCGTCATTCCTTCCCTCCTGGG + Intergenic
1008455947 6:51711040-51711062 AGTGTCCTGCCTTCTGCCCCAGG + Intronic
1008848544 6:55996722-55996744 AGCATGTTTCCTTCTGCCCCAGG + Intergenic
1012625885 6:101402686-101402708 AGAGTCAGTTCTCCTGCCCTAGG + Intronic
1013354766 6:109336967-109336989 AGAGTCAGTCCTCCTGCCCTGGG + Intergenic
1013824276 6:114192757-114192779 AGAGTCATAGCTTCTACCCTAGG + Intronic
1017102352 6:150859844-150859866 ATCATCATTCCTTCTTCCTTGGG - Intergenic
1017486740 6:154909679-154909701 AGGATCATTCCTTCAGCACTGGG + Intronic
1021900965 7:25285228-25285250 AGCTTCTTTGCTTCTACCCTGGG + Intergenic
1024904687 7:54363035-54363057 TGCATCCTTTCTTCTGCCCTTGG + Intergenic
1025123307 7:56324726-56324748 GGCGTAATTCCTTCTTCCTTGGG - Intergenic
1027198461 7:76047692-76047714 AAACCCATTCCTTCTGCCCTTGG - Exonic
1029456498 7:100674798-100674820 GCCGTGCTTCCTTCTGCCCTGGG + Intronic
1033555996 7:142488886-142488908 AAGGCCATTCCCTCTGCCCTAGG + Intergenic
1035028476 7:155842625-155842647 GACGTCACTCCTCCTGCCCTGGG - Intergenic
1037477537 8:19271862-19271884 AGAGTCATTCCTTCTGCATCTGG + Intergenic
1037794852 8:21984617-21984639 AGCTGCCTTCCTTCTTCCCTTGG + Intronic
1044861425 8:96527217-96527239 AGCTTCATTATTTCTGCCTTGGG + Intronic
1049251766 8:141593109-141593131 AGCCTCATTCCCTCCGGCCTGGG + Intergenic
1052048358 9:23820952-23820974 ATCATCATTGCTCCTGCCCTGGG + Intronic
1054779715 9:69155327-69155349 AGCTTCTTTCCCTCTTCCCTAGG + Intronic
1056538930 9:87554832-87554854 AGTGTCAGGGCTTCTGCCCTTGG + Intronic
1056795408 9:89655562-89655584 AGCCCCAGTCCTCCTGCCCTTGG + Intergenic
1057430900 9:94992828-94992850 TGTGTCTTTCCTTCTGTCCTTGG + Intronic
1059416859 9:114167817-114167839 ACCGTCATTCCTGCCGCCTTGGG + Exonic
1059805929 9:117800337-117800359 TGCCTCATGCCTTCTGTCCTAGG - Intergenic
1185819033 X:3184087-3184109 AAAGTCATTCCTTCTCCCCTGGG + Intergenic
1187397193 X:18928868-18928890 AGGGTCATTCATTCCTCCCTTGG - Intronic
1188968006 X:36578927-36578949 AGCTTCTTTCTTTGTGCCCTGGG + Intergenic
1190572986 X:51803417-51803439 AGCGTCATTCCCTCTACCACAGG + Intronic
1200057196 X:153467876-153467898 AGCGGAATACATTCTGCCCTGGG + Intronic