ID: 1078449153

View in Genome Browser
Species Human (GRCh38)
Location 11:11427485-11427507
Sequence ACTCAGCCGAGCAGAGCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078449153 Original CRISPR ACTCAGCCGAGCAGAGCCGT CGG (reversed) Intronic
901084013 1:6599751-6599773 CCTCAGCAGACCAGAGCCCTGGG + Intronic
901847029 1:11989909-11989931 ACTCAGACGAGCGGGGCCCTGGG - Intronic
902079845 1:13813506-13813528 TCCCAGGCGAGCAGAGCCCTGGG - Intronic
902956393 1:19926796-19926818 ACCCAGGCGAGGAGAGCCGGGGG - Intergenic
903296976 1:22350239-22350261 AGTGAGCCGAGCAGAGCAGAAGG - Intergenic
903390959 1:22963318-22963340 CCCCAGCCGAGCCGAGCCGGGGG + Intronic
916499667 1:165376113-165376135 GCTCAGCCGGGCAGAGCTCTCGG + Intergenic
916716718 1:167452624-167452646 TCCCAGCCGAGCAGAGAGGTGGG + Intronic
916741516 1:167650731-167650753 CCTCACACGAGCAGAGCCATTGG - Intronic
917509268 1:175656663-175656685 GCTCATCAGAGCAGAGCTGTTGG + Intronic
923027274 1:230215290-230215312 ACTGAGCCGAGCAGAAGCGATGG - Intronic
923208114 1:231778024-231778046 GTCCAGCCCAGCAGAGCCGTGGG + Intronic
1062868334 10:876589-876611 ACTGAGCCCAGCAAAGCCATCGG - Intronic
1066132702 10:32409662-32409684 ACTAAGCCCAGCAAAGCCATAGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072119696 10:92395598-92395620 GCTCAGGCTAGCAGAGCCGCAGG - Intergenic
1075620270 10:123922329-123922351 ACTGAGCCCAGCAGAGCCTAAGG + Intronic
1077155378 11:1088707-1088729 ACTAAGCAGAGCAGGGCTGTAGG + Intergenic
1078449153 11:11427485-11427507 ACTCAGCCGAGCAGAGCCGTCGG - Intronic
1081358564 11:42144381-42144403 ACTCTGCCCTGCAGAGCCATAGG - Intergenic
1089176983 11:116555825-116555847 CCTCAGTCCAGCAGAGCTGTGGG - Intergenic
1092262331 12:6959420-6959442 ACTCAGGGGAGCAGTGCAGTAGG - Intronic
1093038733 12:14356027-14356049 ACTAAGCCCAGCAAAGCCATAGG + Intergenic
1095237271 12:39812619-39812641 AATCAGCCGGGCGTAGCCGTGGG - Intronic
1104561292 12:129847502-129847524 ACAGAGCTGACCAGAGCCGTTGG - Intronic
1106441974 13:29782878-29782900 ACTCAGCAGTGCAGTGCTGTGGG - Intronic
1108702441 13:52955209-52955231 ACTCAGCAGAGCACATCAGTGGG + Intergenic
1109721625 13:66283105-66283127 ACTGAGCCCAGCAAAGCCATGGG - Intergenic
1116753909 14:48921909-48921931 TGTCAGCCGAGCAGAGCCTAAGG + Intergenic
1122892900 14:104741296-104741318 ACCCAGCTGCGGAGAGCCGTGGG + Intronic
1123500558 15:20877789-20877811 GCTCAGCCGAGCGGGGCCGAGGG + Intergenic
1123557803 15:21451482-21451504 GCTCAGCCGAGCGGGGCCGAGGG + Intergenic
1123594030 15:21888763-21888785 GCTCAGCCGAGCGGGGCCGAGGG + Intergenic
1124368106 15:29088228-29088250 ACTTAGCAGAGCAGAGTCCTGGG + Intronic
1128126585 15:65197613-65197635 ACTCAGCTGAGGAGAGCAATGGG - Exonic
1129169267 15:73797886-73797908 ACTCAGCAGAGCACACCCATGGG - Intergenic
1202966153 15_KI270727v1_random:178654-178676 GCTCAGCCGAGCGGGGCCGAGGG + Intergenic
1132495764 16:262595-262617 AGGCAGGCGAGCAGAGCCATGGG - Intronic
1134114237 16:11536137-11536159 ATGCATCAGAGCAGAGCCGTGGG + Intergenic
1135747933 16:25032982-25033004 AATCAGCCGAGCATAGTTGTGGG + Intergenic
1139661039 16:68421075-68421097 ACCCAGCCCATCAGAGCTGTTGG - Intronic
1139749491 16:69100626-69100648 AGACAGCGGAGCAGAACCGTGGG + Intergenic
1141582747 16:85011412-85011434 ACCAAGCCGAGCCGAGCCGCGGG - Exonic
1141602010 16:85132724-85132746 ACAGAGCCGGGCAGAGCCTTGGG + Intergenic
1142212561 16:88815404-88815426 ACTGAGCCCAGCAGCGCAGTAGG - Intronic
1142739099 17:1920228-1920250 GCACAGGTGAGCAGAGCCGTTGG + Intergenic
1143544695 17:7589192-7589214 ACCCAACCGAGCAGAGGCTTTGG - Exonic
1144560466 17:16316803-16316825 CCTCAGCCGAGCAGAGGCAGTGG + Intronic
1146167356 17:30600537-30600559 CCTCAGCCGACCAGCCCCGTCGG + Intergenic
1149314044 17:55421999-55422021 ACGCAGGCGAACAGAGCCGGCGG - Intergenic
1151262572 17:72928256-72928278 ATTCAGCCAAGGAGAGCAGTTGG + Intronic
1152409041 17:80112735-80112757 GCTCAGCAGAGTAGAGCCGGGGG + Intergenic
1157094403 18:44674345-44674367 ACTTGGCTGAGCAGAGCCATGGG + Intergenic
1163784972 19:19270296-19270318 ACTCAGACGGGCAGTGCGGTAGG + Intronic
1163850616 19:19661183-19661205 CTTCAGCAGAGCAGAGCCCTGGG - Intronic
1168102675 19:54149341-54149363 CATCAGCAGAGCAGAGCTGTGGG - Intronic
926052135 2:9752040-9752062 ACTCAGGCCAGCGGAGACGTGGG - Intergenic
930124666 2:47785983-47786005 ACTCTGCCGAGCACAGCATTAGG + Intronic
932366143 2:71154701-71154723 ACTCAGCTGAGCAGCCCCATTGG + Intergenic
937485196 2:122308388-122308410 CCTCAGCCGAGAAGAGCAGCAGG - Intergenic
948336669 2:237213849-237213871 AGTCAGCCGTGCAGAGCGGGAGG - Intergenic
948475584 2:238216875-238216897 TCTCAGCCCAGCACAGCAGTAGG + Intergenic
1172883759 20:38217956-38217978 ACTCAGCCTCACAGAGCCGGGGG - Intronic
1176170435 20:63694135-63694157 ACTCAGGAGCTCAGAGCCGTAGG - Intronic
1177856487 21:26405954-26405976 ACTCTGCTGAGAAGAGCCCTTGG - Intergenic
1181993023 22:26852009-26852031 ACTCTGCCCTGCACAGCCGTGGG - Intergenic
1182866796 22:33611170-33611192 ACACTGCCTAGCAGAGCTGTGGG + Intronic
1184096710 22:42319992-42320014 AAACAGCAGAGCAGAGCCTTGGG - Intronic
950264409 3:11563556-11563578 CCTCTGCAGAGCAGAGCTGTGGG - Intronic
952263783 3:31766078-31766100 ACAAAGCCCAGCAGAGCCGCTGG + Intronic
958719146 3:97822747-97822769 TGTGAGCCGAGCGGAGCCGTCGG + Intronic
960820474 3:121725268-121725290 ACTAAGCCCAGCAAAGCCATAGG + Intronic
962764436 3:138548723-138548745 ACTCAGATGAACAGAGCAGTGGG + Intronic
988686479 5:33530333-33530355 CCTCATCCCAGCAGAGCAGTGGG + Intronic
994386728 5:99142001-99142023 ACTGTGCCCAGCAGAGCCCTGGG + Intergenic
1001474219 5:172038461-172038483 GCTCAGGAGAGAAGAGCCGTGGG - Intergenic
1003645467 6:7910391-7910413 ACGCCGCAGACCAGAGCCGTCGG + Intronic
1006335408 6:33417960-33417982 ACTCCGCCGAGCAGGACCGCGGG + Intronic
1019180162 6:170181693-170181715 ACCCATCCTAGCAGAGCCTTTGG - Intergenic
1026473375 7:70713058-70713080 ATTCAGATGAGCAGAGCCCTAGG - Intronic
1027472645 7:78592411-78592433 ACCCAGGAGAGCAGAGCAGTTGG - Intronic
1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG + Intergenic
1035845625 8:2861408-2861430 ACTCAGGCAAGCAGAGCCTGTGG + Intergenic
1036800073 8:11784243-11784265 ACTCAGGAGCGAAGAGCCGTCGG + Intronic
1037009116 8:13819039-13819061 ACTGAGCCCAGCAAAGCCATGGG - Intergenic
1045321559 8:101085657-101085679 ACTCACCCCAGCTGAGCCTTTGG + Intergenic
1046471588 8:114682317-114682339 ACTGAGCCCAGCAAAGCCATGGG - Intergenic
1046548082 8:115676533-115676555 CCCCAGCAGAGCAGAGCCCTGGG + Intronic
1046980210 8:120328878-120328900 ACACAGCCGAGCAGAGACTTGGG + Intronic
1190710257 X:53062932-53062954 ACTGAGCCCAGCAAAGCCATAGG - Intronic
1193967589 X:88007509-88007531 ACTCAGAAGAGGAGAGCTGTAGG - Intergenic
1195207098 X:102611834-102611856 CCTCAGCCATGCAGAGCTGTGGG + Intergenic
1195295493 X:103472521-103472543 ACTCAGAAGAGCAGAGCTGTAGG + Intergenic