ID: 1078450357

View in Genome Browser
Species Human (GRCh38)
Location 11:11436355-11436377
Sequence TGGCAAGGGGATGTGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078450357_1078450361 -5 Left 1078450357 11:11436355-11436377 CCACAGGACACATCCCCTTGCCA 0: 1
1: 0
2: 0
3: 27
4: 259
Right 1078450361 11:11436373-11436395 TGCCACCATCGTGACTATGTAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1078450357_1078450362 -4 Left 1078450357 11:11436355-11436377 CCACAGGACACATCCCCTTGCCA 0: 1
1: 0
2: 0
3: 27
4: 259
Right 1078450362 11:11436374-11436396 GCCACCATCGTGACTATGTAGGG 0: 1
1: 0
2: 2
3: 2
4: 49
1078450357_1078450365 23 Left 1078450357 11:11436355-11436377 CCACAGGACACATCCCCTTGCCA 0: 1
1: 0
2: 0
3: 27
4: 259
Right 1078450365 11:11436401-11436423 AAGCTCATCCCAGTTTGCCCAGG 0: 1
1: 1
2: 8
3: 46
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078450357 Original CRISPR TGGCAAGGGGATGTGTCCTG TGG (reversed) Intronic
900122588 1:1055189-1055211 AGGCAGGGGTGTGTGTCCTGAGG - Exonic
900192267 1:1356532-1356554 TGGCAAGGGGAGGTGCCCAAGGG + Intronic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900609307 1:3537743-3537765 TGGTAAGGGGACCTGGCCTGGGG + Intronic
901447110 1:9315285-9315307 TGGCACGGGGCTGTGTCCCTTGG - Intronic
901512554 1:9724696-9724718 GGGCAAGGGCAGGTGTCCTTGGG + Intronic
901814925 1:11788522-11788544 TGGCAAGGGGGTGTCATCTGAGG - Exonic
902295305 1:15463024-15463046 TGGGGTGGGGATGTGACCTGGGG + Intronic
902298151 1:15482556-15482578 TGGGGTGGGGATGTGACCTGGGG + Intronic
902489893 1:16773660-16773682 TAGCAAGGGGACCTCTCCTGTGG - Intronic
902708274 1:18221454-18221476 CTCCAAGGGGATGTGTCCAGAGG - Intronic
905481428 1:38264638-38264660 TGGCCATGAGATGTTTCCTGAGG - Intergenic
905664268 1:39753144-39753166 TGGCCAGGGGCTGTGTCCAGCGG + Intronic
905841570 1:41184670-41184692 TGGCAATGAGAATTGTCCTGTGG + Intronic
907792677 1:57682668-57682690 TGGCAAGGGGCTTTGCCCAGGGG + Intronic
908930939 1:69315434-69315456 TGGCAGAGGCATGTGTTCTGGGG + Intergenic
909534837 1:76725014-76725036 TGCCATGGGGATGTTTCCTGGGG - Intergenic
909813270 1:79958760-79958782 AGGCAAGAGAATGTGTGCTGGGG + Intergenic
913457901 1:119052414-119052436 TGTTAAGGGGATTTGTCATGGGG - Intronic
916749892 1:167714361-167714383 TGGCACCGGGCTGCGTCCTGAGG + Intergenic
918382109 1:183966693-183966715 TGGCACTGGGATGATTCCTGTGG + Intronic
920649698 1:207827604-207827626 TGGGGAGGGGATGTGCCCAGTGG + Intergenic
922468721 1:225862355-225862377 TCCCAATGGGATGTGTCTTGTGG - Intronic
923176971 1:231476079-231476101 TGTGAAGGAGATGTGTACTGAGG - Intergenic
923530548 1:234808868-234808890 TAGCAAGGGGACCTCTCCTGTGG + Intergenic
923712431 1:236397896-236397918 GAGTAAGGGGATGTCTCCTGTGG - Intronic
924427157 1:243962387-243962409 TGGCAACGGGATGTGAACGGGGG + Intergenic
1064124631 10:12649367-12649389 TGGCCAGGAGCTGTGTGCTGGGG + Intronic
1065715616 10:28564299-28564321 TGGGAAGGGAAAATGTCCTGTGG + Intronic
1066456904 10:35580515-35580537 CGGGAAGGGGATGTCACCTGGGG - Intergenic
1067269163 10:44774689-44774711 TGGGAAGTGGGGGTGTCCTGAGG + Intergenic
1067537310 10:47122844-47122866 TGGAAAGGGGGTGAGTTCTGTGG - Intergenic
1068889906 10:62137984-62138006 TGGGTAGGTGATGTGTCCTGAGG + Intergenic
1069992327 10:72323286-72323308 TGGCCAGGGGCTGGGTCCTGCGG - Intergenic
1070170049 10:73926059-73926081 TGGCAATGGGATGTGAGCAGAGG + Intergenic
1070312247 10:75282255-75282277 AGGCAAGGGGAAGTCTGCTGGGG + Intergenic
1070680753 10:78447513-78447535 AGGCAAGGGGATGTGGCAGGAGG + Intergenic
1073073671 10:100810156-100810178 AGGCAAGCGGAGGTGGCCTGCGG + Intronic
1074373842 10:112922786-112922808 TTGCAAGGGGAGGTTTGCTGGGG - Intergenic
1074545585 10:114399845-114399867 TGGAGAGAGGATGTGTCTTGGGG - Intronic
1075194880 10:120347884-120347906 TGGAAAGGGCAAGTCTCCTGTGG - Intergenic
1076040773 10:127246400-127246422 TGACAATGAGATGTGTCCCGTGG - Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1076774533 10:132687447-132687469 TGACATGGGGCTGTGTCCTCAGG - Intronic
1077054009 11:581392-581414 TGACACGGGGATGTGGCCTGTGG + Intronic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1078877823 11:15415726-15415748 TGGCAAGCAGATGGGTCGTGGGG - Intergenic
1079336740 11:19576865-19576887 TGGCCTGGGAAGGTGTCCTGGGG + Intronic
1081351670 11:42061278-42061300 TGGGAAGGGGATTTGTAGTGAGG - Intergenic
1081542693 11:44047763-44047785 TGGCATTAGGATGTGTTCTGAGG - Intergenic
1083745919 11:64736476-64736498 TGGCAATGGGCTGTGTTCTAGGG - Intronic
1084156403 11:67315494-67315516 TGTCAAGAGGTTGTTTCCTGCGG - Intergenic
1084268398 11:68016606-68016628 AGGCAGGGGCAGGTGTCCTGAGG - Intronic
1084614518 11:70226704-70226726 GGGCAAGGAGGTGTGTCCTAGGG + Intergenic
1085037870 11:73310502-73310524 TGGGCAGGGGATGTGACCCGAGG + Exonic
1085351252 11:75799227-75799249 TGGGGAGGGGCTGGGTCCTGTGG + Intronic
1085690923 11:78663087-78663109 TGGCAGGGGGAGGTGAACTGGGG + Intronic
1086996637 11:93365124-93365146 TGGCAAGGGGAGGGATGCTGGGG - Intronic
1087021767 11:93610346-93610368 TTGCAAGGGCATGTGGGCTGAGG - Intergenic
1088781360 11:113136913-113136935 TGGAGAGAGGATGTGTCCAGGGG + Intronic
1088797152 11:113273770-113273792 TGTCATCGGGTTGTGTCCTGTGG + Intronic
1089134994 11:116241901-116241923 GGGCAAGGGTATGGGTCCTGGGG - Intergenic
1089367615 11:117930960-117930982 CAGGAAGGGGATGTGGCCTGTGG - Intergenic
1089647658 11:119890723-119890745 AGGGAAGGGGCTGTGTTCTGAGG - Intergenic
1091587331 12:1823612-1823634 TGGCTGGGGGTTGTGTGCTGAGG - Intronic
1092161231 12:6316511-6316533 GGGGTAGGGGCTGTGTCCTGCGG - Intronic
1092926564 12:13277512-13277534 TAGCAAGGGGATGAGTCCTCTGG - Intergenic
1093264262 12:16983072-16983094 TGTCAAGTGGATGGGTCATGGGG - Intergenic
1094266437 12:28565448-28565470 TGCTAACAGGATGTGTCCTGTGG - Intronic
1094498004 12:31001278-31001300 GTGGAAGGAGATGTGTCCTGTGG - Intergenic
1095490502 12:42728519-42728541 TGGCAAGTGCAAATGTCCTGAGG - Intergenic
1096694394 12:53339282-53339304 TGGGAAGGGAATGGTTCCTGTGG - Intronic
1098471270 12:70846987-70847009 TGGCATGGGGATCTTTCCTGGGG + Intronic
1099034235 12:77565303-77565325 AGGCAAGGTGAAGTGGCCTGTGG - Intergenic
1101364943 12:104063067-104063089 TGGCAAGGGGATGGGGGCTATGG - Intronic
1101393154 12:104321690-104321712 TACCAAGGGGAAATGTCCTGTGG - Intronic
1102582337 12:113897882-113897904 TGGGAATGGGATGTGGCCAGAGG - Intronic
1107457257 13:40566274-40566296 TGGGGAGGGCATGTGTCCTCAGG - Intronic
1108040758 13:46337675-46337697 TGTCCAGGGGATGAGTACTGAGG - Intergenic
1108243110 13:48487467-48487489 TGGGAAGTGTATGGGTCCTGGGG - Intergenic
1110888396 13:80668179-80668201 AAACAAGTGGATGTGTCCTGGGG - Intergenic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1114910996 14:27196036-27196058 AGACAATGGGATTTGTCCTGAGG - Intergenic
1118454490 14:65932152-65932174 TGCCCAGGGGAAGTGTCTTGGGG - Intergenic
1118461723 14:65993452-65993474 TGGCAAAGGAATGTGTCTTGAGG - Intronic
1118995920 14:70835866-70835888 TGGGAAGGGTATGTGTCCAGAGG + Intergenic
1122305915 14:100766313-100766335 TGGCAAGGGGGTATGACCTTGGG + Intergenic
1122434760 14:101687897-101687919 TGGCAATGGGAAGTCACCTGGGG - Intergenic
1122453723 14:101833564-101833586 TCGCAAGGGGGTGTGTCTTTGGG - Intronic
1122861409 14:104584247-104584269 TGGCAAGGGGCTGTGGCCCTGGG + Intronic
1123964281 15:25439208-25439230 TGGGAAGAGGAGGTGGCCTGCGG + Intergenic
1124393780 15:29282942-29282964 TGGTATGGGGGTGTGTCCAGAGG + Intronic
1124613463 15:31224748-31224770 TGGCAACAAGATGTGTCCTCTGG + Intergenic
1124719443 15:32098702-32098724 TGACAAGGGGTGGCGTCCTGGGG - Intronic
1128227063 15:66009374-66009396 TGGGAAGAGGAAGTGTCCTTGGG + Intronic
1128536099 15:68491824-68491846 TGGCAAGGACCTGTGTCCTGTGG + Intergenic
1130995028 15:88898879-88898901 AGACAAGGGGAAGTGTCTTGGGG + Exonic
1131962428 15:97803855-97803877 TGGCTTGGGAATGTGGCCTGAGG - Intergenic
1133049899 16:3111748-3111770 TGGCATGGGGACGTTTCCTAGGG + Intergenic
1133230127 16:4362460-4362482 TGGCAGGGTCATTTGTCCTGGGG - Intronic
1135550834 16:23397047-23397069 AGGCATGGTGGTGTGTCCTGTGG - Intronic
1135988334 16:27201278-27201300 TGGCAGGGGGTGGGGTCCTGGGG + Intergenic
1138359548 16:56416050-56416072 TGGCTGGGGGATGTGACATGAGG - Intronic
1139654381 16:68378442-68378464 TGGCAAGAACATGTGTGCTGTGG + Intronic
1140326063 16:74004970-74004992 TGGCAGGTGGGTGTGTCCTTGGG + Intergenic
1140523471 16:75602300-75602322 TGGGAAGGTGATATGTCCTGAGG + Intronic
1141292018 16:82727073-82727095 TGGCAAGGGGATGAGGGCGGCGG + Intronic
1141633984 16:85304053-85304075 GGCCAAGGGGCTCTGTCCTGCGG - Intergenic
1142243439 16:88957510-88957532 CAGCAAGGGGATGTGTCTGGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142406776 16:89894412-89894434 TTGCAAGGGGAGCTGTCCGGCGG - Intronic
1143408975 17:6697069-6697091 GGGCAAGGCCGTGTGTCCTGAGG + Intronic
1143617708 17:8063849-8063871 TGGAAAGGGGAAGCGTCCTGGGG + Intergenic
1144891291 17:18495841-18495863 AGGCATGGGGCTGTTTCCTGGGG - Intergenic
1145140933 17:20448476-20448498 AGGCATGGGGCTGTTTCCTGGGG + Intergenic
1145769209 17:27480194-27480216 AGGCAAGGGGAGGAGGCCTGGGG - Intronic
1146548265 17:33757783-33757805 TGGGAAAGGGATGTTTCTTGGGG - Intronic
1146944838 17:36866645-36866667 TGGGAGAGGGCTGTGTCCTGAGG - Intergenic
1148094738 17:45044402-45044424 TGGCAAGCGGATGGGTGCGGTGG + Intronic
1150230021 17:63544653-63544675 GGGAAAGGGAGTGTGTCCTGTGG + Intronic
1150965284 17:69960859-69960881 CTGCAAAGGGATGTGTCCTTGGG + Intergenic
1152259472 17:79259347-79259369 TGGCAAGAGGGTGTGTTCTGGGG + Intronic
1152819875 17:82432129-82432151 TGGCAAGGGGAGGAGGTCTGTGG - Intronic
1153825437 18:8870061-8870083 TGGCAAGGGGTTGTGTCCCTAGG - Intergenic
1159265956 18:66079290-66079312 TAGAAGGGGGATGTGTCATGGGG + Intergenic
1159330536 18:66988678-66988700 TAGCAATGAGAGGTGTCCTGAGG - Intergenic
1160179037 18:76618678-76618700 GGTCAAGGGGCTGTGTCTTGAGG + Intergenic
1160443715 18:78911946-78911968 TGGCCTGGGGCTGTGGCCTGAGG - Intergenic
1160458273 18:79018453-79018475 TGGCATGTGTAAGTGTCCTGGGG + Intergenic
1160513012 18:79463080-79463102 TGGGAAGGGGATGGGTCCTTGGG - Intronic
1160541604 18:79627023-79627045 TGGCCCGGTGATGTGTCCGGCGG - Intergenic
1160583411 18:79900234-79900256 TGGGAAGGTGATGTGGCCTTGGG - Intergenic
1161700673 19:5793281-5793303 TGGCAAGGGAAGGCTTCCTGGGG + Intergenic
1162026292 19:7895756-7895778 TGGCAAGGGGGTGTGACCAGAGG + Intronic
1164259567 19:23557806-23557828 TGGGAAGGGGATGTCTCCCCAGG - Intronic
1164806294 19:31119712-31119734 TGGCCAGGGATTGTGTCATGTGG + Intergenic
1165000225 19:32755018-32755040 TGGCAACAGGATGTGTCCCAAGG + Intronic
1165065140 19:33224412-33224434 TGGCCAGGGGCTGTGTTCAGGGG + Intronic
1165769647 19:38371730-38371752 TGGTGAGGGGAGTTGTCCTGAGG - Intergenic
1167455388 19:49594958-49594980 TGGCAGGGGGCGGTGTCTTGGGG + Exonic
1168158119 19:54489544-54489566 TGGCATGTGGATGAGCCCTGAGG + Intergenic
1168627719 19:57932272-57932294 TGGGAAGGGGATTTGTGCTCAGG + Intronic
926111930 2:10189148-10189170 TGGGAAGGGCGTGTGTTCTGGGG - Intronic
928682261 2:33714549-33714571 TGGCAAGGGAATGTATTTTGGGG + Intergenic
929008835 2:37421438-37421460 GAGCAAGGGGATGTGTGATGTGG - Intergenic
931134843 2:59386746-59386768 GGCCAAGGGAATGTGTCCTATGG + Intergenic
933437839 2:82271147-82271169 TAGCAAGGGAAGGGGTCCTGGGG + Intergenic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
935340320 2:102053690-102053712 TGTCCAGGGAATGTGTCCAGGGG - Intergenic
935579482 2:104744317-104744339 TGACACGGGGCTGAGTCCTGGGG - Intergenic
936042650 2:109161498-109161520 TCGTAAGGCGATGTTTCCTGGGG + Intronic
937028429 2:118718297-118718319 TGTCCAGGAGATGTGTCCTCTGG + Intergenic
937816268 2:126254026-126254048 CTGCAAGGGGATGAGTCCTCTGG + Intergenic
938915004 2:135929200-135929222 AGTCAAGGGGAGGTGTCCTCAGG - Intronic
939905256 2:147906066-147906088 TGGCAAGGAGATGTGTATTTAGG + Intronic
941254952 2:163217362-163217384 TGGGAAGGTAATGTGTCCTGAGG - Intergenic
942890169 2:180979929-180979951 TGCCAAAGGGAAGTGTCCTTCGG - Intronic
944658329 2:201899006-201899028 TGGAAAGGGGAGGTGTTGTGCGG + Intergenic
944966804 2:204944385-204944407 GGGCAAGGAGATGTGCCCTTTGG + Intronic
946166443 2:217866936-217866958 TGACAAGGGTAGGAGTCCTGAGG - Intronic
948064329 2:235065524-235065546 AGGAAAGGGGATGTGTGTTGAGG + Intergenic
948423972 2:237876451-237876473 TGGGCAGAGGATGTGGCCTGGGG + Intronic
948836791 2:240629738-240629760 TGGGAAGAGGATCTGTCCAGGGG + Intronic
1169870832 20:10246506-10246528 TGGCAGGGGAATGAGTCCTATGG + Intronic
1170966286 20:21074720-21074742 TGGCAAGGGTTTTTTTCCTGAGG + Intergenic
1171020561 20:21580957-21580979 AGGCAAGGGAGTGTGTCCAGAGG - Intergenic
1171511098 20:25685602-25685624 GAGCAAGGGGAAGTGCCCTGGGG - Exonic
1172039020 20:32030953-32030975 GGGAAAGGGAACGTGTCCTGGGG + Intronic
1172657553 20:36546336-36546358 TGTCACGGGGCTGTGTCCTCTGG - Intronic
1172885824 20:38230103-38230125 TGGCTAGGGGCTGGGTCCCGAGG + Intronic
1172896570 20:38304457-38304479 GGGCAAGGGGACCTGCCCTGAGG - Intronic
1173867007 20:46318693-46318715 TGGCAAGAGGAGGTGTCCGTAGG - Intergenic
1174684176 20:52437763-52437785 TGGCAAGGAGATGAGGGCTGAGG - Intergenic
1175191793 20:57216546-57216568 GGGCGAGGGGCTGTCTCCTGAGG + Intronic
1175191804 20:57216588-57216610 GGGCGAGGGGCTGTCTCCTGAGG + Intronic
1178234969 21:30831182-30831204 TGGTAAGAGGTTGTGTCCTCAGG + Intergenic
1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG + Intronic
1182452339 22:30428997-30429019 TGGCCAGAGAATCTGTCCTGAGG - Exonic
1183590137 22:38775230-38775252 AGGCAAGGGGGTGTGCCCTTGGG - Intronic
1184284789 22:43464498-43464520 AGGCAAGGGGATGAACCCTGGGG - Intronic
1184634228 22:45813592-45813614 TGGCAAGGGCATCAGTCCTGTGG + Intronic
1184655021 22:45936702-45936724 AGGGAAGGGGGTGTGTGCTGGGG + Intronic
949948296 3:9207727-9207749 TGGGAAGGGGATGTGATCTTGGG + Intronic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
960527046 3:118721684-118721706 TGTCATGGTGATGTGTTCTGTGG - Intergenic
962429687 3:135307643-135307665 TGTTAAGGAGATGTGTCCAGAGG + Intergenic
964656838 3:159076592-159076614 CAGCAAGGGGATGTGCACTGGGG - Intronic
965330142 3:167362704-167362726 TGGAAAGGGGCTAGGTCCTGTGG - Intronic
965397069 3:168172949-168172971 TGGCAAAGGGATGGGTCCCAGGG - Intergenic
965979765 3:174673637-174673659 TGGGAAGGGGGTGTGTTCGGGGG + Intronic
966002365 3:174965884-174965906 AGGCAAGGAGAGGGGTCCTGGGG + Intronic
966361559 3:179135615-179135637 TGGGAAGGGTATGTGTGTTGTGG + Intergenic
966778147 3:183560996-183561018 TGGCAAGAGGAGTTGGCCTGAGG - Intergenic
967362414 3:188646887-188646909 TGGCAATGAGATGTGTATTGAGG - Intronic
968564103 4:1300636-1300658 TGGAAAGGGTATGCGACCTGCGG - Intronic
968855050 4:3113810-3113832 TGGCAAGGAGAGAAGTCCTGTGG + Intronic
969937014 4:10692319-10692341 TGGCAAGGGCAAGTGATCTGAGG - Intergenic
975810665 4:78165706-78165728 TGGCTAGGGGTTGGCTCCTGTGG + Intronic
977207266 4:94177379-94177401 TGGCAAGGGGTGGTGGCCGGTGG - Intergenic
977449301 4:97174820-97174842 TGGCAAGGGGAAGTATCCTCAGG - Intergenic
978342199 4:107730306-107730328 TGGAATGGGGATGTGTGTTGGGG - Intergenic
978829981 4:113072301-113072323 TGGAAAGGGGATCTGGCTTGAGG - Intronic
980044603 4:127973664-127973686 TGGCAAAGGTATGGCTCCTGTGG + Intronic
982465198 4:155721917-155721939 AGGAAAGGGGTGGTGTCCTGAGG + Intronic
989586205 5:43075516-43075538 TGGCCAGGGAATGTGTCTTCCGG + Intronic
989973801 5:50556800-50556822 AGGCAAGGAGAGGTGTCCTAAGG - Intergenic
990514257 5:56517395-56517417 TGGGAAGGGAGTGTGACCTGGGG - Intronic
991532725 5:67633792-67633814 GGGCAAGGAGTTGAGTCCTGAGG + Intergenic
991666173 5:69001902-69001924 TGGCAAGGGGCTGTGTACCAAGG + Intergenic
992502360 5:77355408-77355430 TGGCAATGGGATCTGTGCTGGGG + Intronic
995056544 5:107765685-107765707 TGGGAAGAGGTTGTGTCCAGAGG + Intergenic
996970750 5:129364903-129364925 TGGGAAGGGCATGTGTTTTGGGG - Intergenic
998524162 5:142827243-142827265 TGGCATGGCCCTGTGTCCTGTGG + Intronic
999176550 5:149635829-149635851 TGGCCAGGGGCAGTTTCCTGAGG + Intergenic
1000359685 5:160435552-160435574 TGGGAAGGGGGTATGTCCTGTGG + Intergenic
1001594385 5:172888491-172888513 TGACAAGGGGATGTGATCTAAGG + Intronic
1001702798 5:173719814-173719836 TGGCAGGGGGGTGAGGCCTGAGG - Intergenic
1003101069 6:3177028-3177050 AGGCAAGGGCATGTCACCTGCGG + Intergenic
1003513828 6:6802604-6802626 TGGCAGGGGGGTGTGTCCCAAGG - Intergenic
1005406512 6:25494497-25494519 TAGCAAGGGGATGTATTCAGAGG + Intronic
1005895573 6:30174389-30174411 TGGCAAGGGGAAGTGTTGAGTGG - Intergenic
1005896339 6:30182245-30182267 TGGCGATGGGATTTGTCCAGGGG + Intergenic
1006397042 6:33794316-33794338 TGGCAAGGGGTTGAGTGCGGAGG + Intergenic
1006433081 6:34010103-34010125 AGGCAAGGGGAGGGGGCCTGTGG - Intergenic
1006844910 6:37055503-37055525 TGGCAAGGTGAGGTGTCAGGTGG - Intergenic
1007102779 6:39261529-39261551 TGGCAAAGGGATGTGTGTTCGGG + Intergenic
1007341695 6:41194682-41194704 AGGCAAGGTGATGAGTCCTGGGG + Exonic
1010051075 6:71505113-71505135 TGTCCAGGGGATGTGTCGGGTGG - Intergenic
1014382505 6:120760161-120760183 TGGAAAGGCTATGTCTCCTGGGG + Intergenic
1014703372 6:124716462-124716484 GGGCAAGGGCATGTTTCCTAAGG - Intronic
1015126954 6:129765504-129765526 TTACTAGGGGATGTGTCCTCAGG + Intergenic
1015223828 6:130833856-130833878 GGGAAAGTGCATGTGTCCTGGGG + Intronic
1017300519 6:152852371-152852393 TGGCAAGGGGATGGGCACTAAGG - Intergenic
1018152815 6:160956160-160956182 TGGCAAGGGCAAGGGCCCTGAGG + Intergenic
1021062092 7:16125803-16125825 TGACAAAGGCATGTGTCCTGAGG - Intronic
1023157350 7:37264392-37264414 AGGCAAGTAGATGTGACCTGTGG + Intronic
1023517953 7:41020975-41020997 TGGACAGGAGATGTGGCCTGTGG + Intergenic
1024251598 7:47509682-47509704 AGGCAGGGGGCTGTCTCCTGTGG - Intronic
1024544420 7:50505452-50505474 TAGCAATGCCATGTGTCCTGAGG + Intronic
1024598625 7:50960972-50960994 GGGCAAGGGGGTTTCTCCTGAGG + Intergenic
1024919779 7:54544938-54544960 GGGAAAGGGAATTTGTCCTGGGG + Intronic
1027170188 7:75866425-75866447 TCCCAAGGGGATGTGTGCTTGGG + Intronic
1030972305 7:116075583-116075605 TGGGAACGGGATGAGGCCTGTGG + Intronic
1031678316 7:124638613-124638635 TGGCAAGGGCAAATGTTCTGTGG - Intergenic
1031892063 7:127306260-127306282 TAGAAAGGGGAACTGTCCTGAGG + Intergenic
1034558264 7:151863343-151863365 TGGGAAGGGGATGTGAACTTGGG - Intronic
1035007432 7:155676907-155676929 TAGAAAGGGAATGTGTACTGTGG - Intronic
1035296991 7:157872902-157872924 CAGCAAGGGGAGGTGGCCTGCGG - Intronic
1035655441 8:1301763-1301785 TGGGAAGGGGAGGGGTGCTGTGG - Intergenic
1036116698 8:5967268-5967290 TGTCAAGGGAATTTGACCTGGGG - Intergenic
1036601763 8:10267540-10267562 GGGCAAGTGGATTTGTCCCGGGG + Intronic
1039178651 8:34838473-34838495 ATGGTAGGGGATGTGTCCTGAGG - Intergenic
1039822452 8:41146058-41146080 TGGGACGGGGATGTGTCTGGGGG - Intergenic
1043435213 8:80231390-80231412 TGGCAAGAGGCTGTATCCTGAGG - Intergenic
1043726857 8:83622395-83622417 TGGCAAGGAGCTGTGTTCTTTGG + Intergenic
1044806959 8:96018177-96018199 TGGCAGGGCTATGAGTCCTGAGG + Intergenic
1045358554 8:101411357-101411379 TGGCAGGAAGGTGTGTCCTGGGG + Intergenic
1045816259 8:106280560-106280582 TTGCAAGGGGATGGGTGATGGGG + Intronic
1046452674 8:114414778-114414800 AGGCAAGAGGATGTGTGCAGGGG + Intergenic
1046847703 8:118936563-118936585 TGTTAAGGTGATCTGTCCTGTGG - Intronic
1049006932 8:139861686-139861708 TGGAGAGGGGATGTGCTCTGGGG + Intronic
1049298156 8:141854842-141854864 GGGCTGGGGGAGGTGTCCTGGGG + Intergenic
1049382321 8:142323503-142323525 TGGCAAGGGGAGGCCTCGTGAGG + Intronic
1051617600 9:19021125-19021147 TGGCATGAGGCTGTCTCCTGTGG - Intronic
1051827321 9:21234436-21234458 TGGGATGGGAGTGTGTCCTGTGG - Intronic
1052879389 9:33591541-33591563 TGGCAATGGGATGTTTCATATGG - Intergenic
1054860394 9:69946922-69946944 TGGCCAGTGTATGTGTCATGAGG + Intergenic
1056210060 9:84357005-84357027 TTACAAGGGGATGTGTGCTATGG - Intergenic
1057187512 9:93065105-93065127 TGGGAAGGGGATGTGCCCAGGGG + Intronic
1059712916 9:116886041-116886063 AGGCAAGAGGATCAGTCCTGAGG - Intronic
1060510455 9:124228551-124228573 AGGCCAGGGCCTGTGTCCTGGGG - Intergenic
1060817291 9:126641800-126641822 TGGCAAGAGGCTGGGTGCTGTGG - Intronic
1062068285 9:134540603-134540625 TGGGAAGGGGGTGTCTCCAGGGG - Intergenic
1062324474 9:136005541-136005563 TGGCAAGGGGATGGCGCTTGAGG - Intergenic
1062468708 9:136692708-136692730 GGGCAGGGGCCTGTGTCCTGGGG + Intergenic
1062550012 9:137081823-137081845 TGGCAGTGGGATGTGTGCTCAGG + Intronic
1062616496 9:137398946-137398968 TGTCTTGGGGATGTGTCTTGGGG - Intronic
1186079431 X:5913921-5913943 AGGCAAGAGAATGTGTCCAGGGG - Intronic
1195702841 X:107717583-107717605 GGGCAAGTGGATGAGTGCTGGGG - Intronic
1197727017 X:129783131-129783153 GGCCAAGGGCATGTATCCTGTGG - Intronic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1199547409 X:149020409-149020431 TAGAAAGGGGCTGTGTGCTGGGG + Intergenic
1199701544 X:150380987-150381009 AGGGAAGGGGATGGGTGCTGTGG - Intronic
1202232811 Y:22672554-22672576 TGGGCAGGGCATGTGGCCTGGGG + Intergenic
1202310345 Y:23523604-23523626 TGGGCAGGGCATGTGGCCTGGGG - Intergenic
1202560457 Y:26146990-26147012 TGGGCAGGGCATGTGGCCTGGGG + Intergenic