ID: 1078451286

View in Genome Browser
Species Human (GRCh38)
Location 11:11442827-11442849
Sequence GTCCCTCCCTCCCAGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078451286_1078451297 6 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451297 11:11442856-11442878 CTCAGGGGACACTGGTGAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 367
1078451286_1078451293 -10 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451293 11:11442840-11442862 AGGGAGGGACATGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 38
4: 394
1078451286_1078451294 -9 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451294 11:11442841-11442863 GGGAGGGACATGGGCCTCAGGGG 0: 1
1: 0
2: 4
3: 40
4: 411
1078451286_1078451299 27 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451299 11:11442877-11442899 GGGCAAAGTCATTACTGATAAGG 0: 1
1: 0
2: 3
3: 14
4: 139
1078451286_1078451298 7 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451298 11:11442857-11442879 TCAGGGGACACTGGTGAGAAGGG 0: 1
1: 0
2: 4
3: 26
4: 342
1078451286_1078451295 -2 Left 1078451286 11:11442827-11442849 CCTAACCCCTGGGAGGGAGGGAC 0: 1
1: 0
2: 2
3: 29
4: 232
Right 1078451295 11:11442848-11442870 ACATGGGCCTCAGGGGACACTGG 0: 1
1: 0
2: 0
3: 34
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078451286 Original CRISPR GTCCCTCCCTCCCAGGGGTT AGG (reversed) Intronic
900104340 1:975966-975988 GCACCTCCCTCCCAGGCGTGGGG + Exonic
900199007 1:1394303-1394325 GTCCCTCACTCCCAGCGTTGTGG - Intronic
900360537 1:2286739-2286761 CTCCCTCCCTCCCAAGGCTCCGG + Intronic
900423377 1:2565235-2565257 GTCCCTGGCTCCCAGGGCTCTGG + Intronic
900537972 1:3188185-3188207 GTCCCTCCCTGCCTGGTGTGTGG + Intronic
901872236 1:12144941-12144963 CCCCCTGCCTCCCAGGGCTTGGG - Intergenic
902390190 1:16099225-16099247 CTCTCTCCTTCCCAGAGGTTGGG + Intergenic
903263754 1:22144324-22144346 GTCCCACCTCCCTAGGGGTTGGG + Intergenic
903730962 1:25494896-25494918 ACCCCTTACTCCCAGGGGTTTGG - Intronic
904407579 1:30303137-30303159 GTCCCTCCCTACTGGGGGCTTGG + Intergenic
906295846 1:44648733-44648755 GTCCCCCTCTCCCTGGAGTTTGG + Intronic
908089177 1:60668756-60668778 CTCCCTCCCTCCCAGTGGACAGG + Intergenic
908809219 1:67962278-67962300 TCCCCTTACTCCCAGGGGTTTGG - Intergenic
911440013 1:97914048-97914070 GTCCCTACCTCCCAGGTGCTTGG - Intronic
911571603 1:99524038-99524060 GTGTCTCACCCCCAGGGGTTGGG + Intergenic
912797411 1:112701357-112701379 GGCCCTCCCTCCCAGCGCTCTGG - Exonic
915340937 1:155176246-155176268 GTCCCTCCCTCCCCAGGCCTTGG - Intronic
918309742 1:183277122-183277144 GTACCTACGTCCCATGGGTTTGG - Intronic
920317519 1:205088662-205088684 GTGCCTCCCACCCAGGAGGTGGG - Exonic
920418176 1:205812670-205812692 TTCTCTCCCTCCTCGGGGTTGGG - Intronic
922561021 1:226569710-226569732 GTCCCTCAATCCCAGGCTTTGGG - Intronic
922609351 1:226912949-226912971 TTCTCTCCCTCCCAGGGGCCAGG + Intronic
922718195 1:227887609-227887631 GTCCCTCCCGCCCTGAGCTTAGG + Intergenic
924619827 1:245650897-245650919 GCACCTCCCTCTCACGGGTTTGG + Intronic
1063529632 10:6819076-6819098 GTTCCTCCCTCCGTGGGATTGGG + Intergenic
1063607378 10:7534572-7534594 GGCCCTCCCTCCAAGGCGTTTGG - Intergenic
1064164551 10:12974952-12974974 ATTCCTACCTCGCAGGGGTTAGG - Intronic
1065051173 10:21793290-21793312 GGCGCTCCATCTCAGGGGTTGGG + Intronic
1067295935 10:44975218-44975240 CTCCGTCTCTCCCAGGGGTGCGG + Intronic
1070046540 10:72843321-72843343 GTACCTGCCTGCCAGGAGTTAGG - Intronic
1070730112 10:78821300-78821322 GTGCCTCCCACCCAGGGCTGTGG + Intergenic
1070828691 10:79405733-79405755 GTCCCCTCCTCCCAGGGCTGTGG - Intronic
1072181819 10:92990777-92990799 GTCTCAACCTCCCTGGGGTTGGG - Intronic
1073466199 10:103695881-103695903 GTCCCTCCCTGCAGGGGGTGTGG + Intronic
1075999495 10:126904224-126904246 GTCCCTACCTCACAGAGGTAGGG + Intergenic
1076688748 10:132209954-132209976 CTCCCTCCCTCCCAGGGCCTTGG - Intronic
1077150144 11:1069438-1069460 GTGCCTTCCTCCCAGGGTTGAGG + Intergenic
1077376966 11:2209626-2209648 GGCCCTGCTTCCCAGGGGGTGGG + Intergenic
1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG + Exonic
1077440179 11:2564939-2564961 GTCCCTCCCTACCACGGAATAGG - Intronic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1081850932 11:46274716-46274738 CTCCCTCCCTCCCAGTTCTTGGG - Intergenic
1081856033 11:46304599-46304621 GTCCCTGCCTTCATGGGGTTTGG - Intronic
1082771223 11:57209208-57209230 GTCCCTACCTCCTAGGGATGTGG - Intergenic
1083299149 11:61731203-61731225 ACCCCTCCCTGCCAGGGGTTGGG + Intronic
1083429022 11:62604194-62604216 TTCCCTCCCTTCCAGGTGGTTGG - Exonic
1083714289 11:64567019-64567041 CTCCCACGCTCCCAGGGGCTGGG - Intronic
1084183661 11:67458925-67458947 CTCCCTACCTCCCAGAGGTCTGG - Exonic
1088253882 11:107884904-107884926 TTCCCTCCTTCCCAGAGGTGAGG - Intronic
1088517300 11:110651846-110651868 GTCCCTCCTTCTCAGTTGTTTGG - Intronic
1089176064 11:116549719-116549741 CTCCCTCCCTCCCAGGAATGGGG + Intergenic
1089335896 11:117723812-117723834 TTCCCTCCCTCCCAGGGTGTTGG - Intronic
1089395800 11:118135873-118135895 CCCCCTCCCACCCTGGGGTTGGG - Exonic
1090403851 11:126465783-126465805 CTCCCTCCCTGCCCGGGCTTTGG - Intronic
1090880028 11:130825200-130825222 GTCCCTTCCCCCAAGGGCTTCGG + Intergenic
1090932303 11:131308942-131308964 ATGCCTCCCTCCCAGGAGGTTGG - Intergenic
1090965918 11:131597592-131597614 GTCCCTCCTTCCCAGGGGTAAGG - Intronic
1091667441 12:2429563-2429585 TTTCCTCCCTCCCAGGGTTCAGG + Intronic
1092144625 12:6205942-6205964 GTTCCTCCCTCCCCCAGGTTGGG + Intronic
1101840162 12:108322255-108322277 GTGCATACCTCCCAGGGCTTGGG + Intronic
1101878510 12:108610829-108610851 GCCTCTCCCTCTCAGGGGCTTGG + Intergenic
1102950274 12:117026484-117026506 GTCCCTGCCTCCCTGGGGTTGGG - Intronic
1103645721 12:122391036-122391058 GTCCCGGCCTCCCAAGTGTTGGG - Intronic
1104320637 12:127747644-127747666 CTCCCTCCCTCCCTGAGGATAGG + Intergenic
1106719976 13:32427481-32427503 GTCCCTCCCGACCTGGGGCTGGG + Intronic
1107014297 13:35696184-35696206 CTCACTCCCTCCCATGGTTTTGG + Intergenic
1108593866 13:51934163-51934185 GTCCCACCCTCCCAGGTGACAGG + Exonic
1110133368 13:72035184-72035206 ATCCCTCCCTCTCAGGGCTTTGG + Intergenic
1111078864 13:83276562-83276584 CCCCGTCCCTCTCAGGGGTTGGG + Intergenic
1114422080 14:22592748-22592770 TTCCCTCCCTCCTAGCTGTTTGG + Intergenic
1115148697 14:30257933-30257955 GTCTCTTCCTCCCAGTGGTTGGG + Intergenic
1115812964 14:37130984-37131006 CTCCCTCCTTCCCAGTGGTGGGG - Intronic
1117212735 14:53517890-53517912 GTCCTTCCTTCCCAGGGGGCAGG + Intergenic
1117487420 14:56212457-56212479 TTCCCTGCCTCCCTGGGATTGGG + Intronic
1117766134 14:59085381-59085403 CTCTCTCCTTCCCAGAGGTTAGG + Intergenic
1118284089 14:64455244-64455266 GTCCCTACCTCCTAGGGCTGTGG - Intronic
1118777091 14:68979691-68979713 CCCCCTCCCACCCCGGGGTTTGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119478995 14:74948216-74948238 CTCCCAGCCTCGCAGGGGTTCGG - Intronic
1120722163 14:87901175-87901197 ATCCCTCCTTCCCAGGGAATAGG + Intronic
1120907960 14:89636867-89636889 ATCCCTGCCTTCCAGGGCTTTGG + Intronic
1121004797 14:90483243-90483265 GGCCCTGCCTTCCAGGAGTTTGG - Intergenic
1121446286 14:93981196-93981218 CTTCCTCCCTCCCAGGACTTGGG - Intergenic
1121566647 14:94914923-94914945 ATCCCTCCCTCCCAGGGACTCGG - Intergenic
1121815294 14:96924129-96924151 GTCCCCTCCACCCAGGGGCTTGG + Intronic
1122124608 14:99572257-99572279 GTCCCTCCCTCCCCAGGGATGGG + Intronic
1122634375 14:103123305-103123327 GTCCCTGCGTCCCAGGGGCTGGG - Intergenic
1125767819 15:42146922-42146944 GCTCCTCCTCCCCAGGGGTTAGG + Intronic
1127841600 15:62836359-62836381 CTCCCTGACTCCCAGGGTTTGGG + Intronic
1127993070 15:64134866-64134888 GCCCATCCCACCCAGAGGTTTGG + Intronic
1128146423 15:65334665-65334687 GACCGGCCCTCCCAGGGGGTGGG + Intronic
1129189708 15:73930226-73930248 GGCCCTCCCTGTCAGGGGCTAGG + Intronic
1130828442 15:87573625-87573647 GTCCCTCCCTCCCAGGAGGCTGG + Intergenic
1131076054 15:89495694-89495716 GGACCTCCTTCACAGGGGTTGGG - Intronic
1131248836 15:90817962-90817984 GTGCCTGCCTCCCAGGGCTGCGG - Intergenic
1131450276 15:92533478-92533500 GTCCCTCCAGCCTAGGGGTGAGG + Intergenic
1133164914 16:3939405-3939427 GTCCATCCCTCCCAGGGATCGGG - Intergenic
1134409645 16:13993351-13993373 GTCCCTACCTCATAGGGGTTTGG + Intergenic
1135047819 16:19168850-19168872 GACCCTCCATCCCGGGGTTTGGG - Intronic
1135538869 16:23314876-23314898 GGGCCTCCCTCCCAAGGTTTTGG + Intronic
1136021908 16:27445861-27445883 CTCCCTCCTTCCCTGGGGCTTGG - Intronic
1137529647 16:49270389-49270411 CTCTCTCCCTCCCTGGGGATAGG - Intergenic
1137675047 16:50299961-50299983 GCCCCTGCTTCCCAGGGATTGGG + Intronic
1139439738 16:66960180-66960202 GTCCTGCCCTCCCTGGGGGTGGG + Intergenic
1140565895 16:76042336-76042358 GTCCCTGGTTCTCAGGGGTTGGG + Intergenic
1141646497 16:85370649-85370671 CTCCCTCCCTCCCATGGGGACGG + Intergenic
1142095820 16:88238911-88238933 CTCCCTCCCTCCCATGGCCTTGG + Intergenic
1142418366 16:89955338-89955360 GTCACTCCCTCCCAGGTGGCAGG + Intronic
1142885978 17:2912275-2912297 CACCCTCTCTCCCTGGGGTTGGG + Intronic
1143137612 17:4720490-4720512 GGCCCTCCCTCTGAGGGCTTGGG - Intronic
1146500121 17:33356912-33356934 CTTCCTTCCTCCCAGAGGTTGGG - Intronic
1146896428 17:36545153-36545175 GTCGATCCCTCCCAGGGGCGGGG + Intronic
1147026448 17:37588945-37588967 GTCCCTCCTTTCCAGGTGTAGGG - Intronic
1147142073 17:38465677-38465699 GTCCCTCCATCCCCGGGAATGGG - Intronic
1147337761 17:39737705-39737727 CCCCCTCCCTCCCAGGTGGTCGG + Intergenic
1147705684 17:42423327-42423349 GTCCCTCCCTTTCTGGGGTGGGG - Exonic
1149866110 17:60151903-60151925 GTCGCTCCCGGCCAGGGGTCTGG - Intronic
1150010035 17:61494842-61494864 GCCCCCCACTGCCAGGGGTTTGG + Intergenic
1152181856 17:78827209-78827231 CACCCACCCTCCCAGGGCTTTGG - Intronic
1155261028 18:24042547-24042569 GACCCTGCGACCCAGGGGTTGGG + Intronic
1156463110 18:37332684-37332706 GCCCCTCCCTGCTAGGGGTTTGG + Intronic
1158960738 18:62585827-62585849 GTTCCTCCCTCACAGGGCTGTGG - Intronic
1160679561 19:406541-406563 GACGCCCCCTCCCAGGGGTCAGG - Exonic
1160879337 19:1312480-1312502 GTCCCTGCCTCCCAGGTGCTGGG + Intergenic
1160892121 19:1384406-1384428 GCCCTTACCTCCCAGGGGTGGGG - Intronic
1161507982 19:4654293-4654315 GTGCCCACCTCCCAGGGGTGAGG + Exonic
1163033498 19:14559067-14559089 GGCCCTCCCTCTGAGGGGTGGGG + Intronic
1164826729 19:31289633-31289655 GTGCCCCACTCCCAGGGGTGGGG + Intronic
1165382002 19:35488325-35488347 GTCACTCCCTCCCAGAGATCAGG + Intronic
1165446595 19:35860198-35860220 GTTCCTCCATCCCAGGAGTCTGG - Intronic
1166467370 19:43044302-43044324 CTCCCTCCCTCCCAGGAATCAGG - Intronic
1166662133 19:44654128-44654150 GTCCCTCAGACCCAGGGGTCCGG - Intronic
1166862538 19:45818475-45818497 TTCCCTCCCTAGCAGGGGTGGGG - Intronic
1167751703 19:51384588-51384610 GTCCCTCCCTCCCTGGCTTCTGG - Intronic
1167781895 19:51603804-51603826 TTCCCTTCCTTCCAGGGTTTTGG - Intergenic
1167799309 19:51729927-51729949 CTCCCTCCCTCCCTGGATTTCGG - Intergenic
925428053 2:3767522-3767544 CTCCCTCCCTCCCAGTGCCTTGG - Intronic
925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG + Intergenic
926862177 2:17321137-17321159 TTCCCTCCCTCTCAGGGATATGG - Intergenic
927643686 2:24861721-24861743 GTCACTCCCTCCCAAGGCATTGG - Intronic
927877876 2:26670813-26670835 TTCCCTCCCTCCCTCAGGTTAGG - Intergenic
934719610 2:96564460-96564482 GCCCCTCCCTGGCAGGGGTCGGG - Intergenic
935241027 2:101178377-101178399 GTCCCTCTGTCCCAGGTCTTTGG + Intronic
936252355 2:110876447-110876469 CTCCCTCCCTCCCAGAGGGACGG - Intronic
937121423 2:119442201-119442223 GACCCTCCCTCCCTGGTATTTGG + Intronic
937199014 2:120185020-120185042 GTCCCCCCCTCCCCAGGTTTAGG - Intergenic
938983192 2:136546237-136546259 GCCCCTCCCTCTGAGGGGTTTGG - Intergenic
939629594 2:144516684-144516706 CTCCCTCCCACCCCGGGGTCTGG + Intronic
941928081 2:170915632-170915654 GCCCCTCACTGCCCGGGGTTGGG + Intergenic
943791906 2:191942671-191942693 AGCCCTCCCTCCCAGGGATGTGG - Intergenic
944708161 2:202311766-202311788 GTCACTTACGCCCAGGGGTTCGG + Intergenic
946203856 2:218089428-218089450 GTCCCTCCCTTCCCTGGGGTGGG - Intronic
946225222 2:218260952-218260974 GTCCCACCCTCCCAGAGGCGGGG + Intronic
948167890 2:235877372-235877394 GGCCATCCGTGCCAGGGGTTAGG + Intronic
948479409 2:238240549-238240571 GACCCTGCCTCCCCGGGGCTTGG - Intronic
948761889 2:240197419-240197441 GTCCCTCCCTGCCAGCTGCTTGG + Intergenic
949050314 2:241894445-241894467 GACACTCCCTGCCAGGGGTGGGG + Intronic
1169786658 20:9366543-9366565 CTCACTTCCTTCCAGGGGTTAGG + Intronic
1171393736 20:24817625-24817647 GGCCCTCCCTCCCAGAGGTGGGG - Intergenic
1174103087 20:48142138-48142160 GTCCCTTCCTCCTAGGGGATGGG + Intergenic
1174390581 20:50216260-50216282 GTCCCAGCCTCCCAGGGGCGTGG - Intergenic
1175853703 20:62107511-62107533 GTCCCTACCTGCCTGGGGTCAGG + Intergenic
1177180416 21:17739000-17739022 TCCCCTCCCTCCCTGGTGTTGGG + Intergenic
1177211578 21:18077899-18077921 GTCCATCCCTAGCAGGGGTTGGG - Intronic
1178917886 21:36719157-36719179 GTGGCTCCCGCCCAGGGGTGTGG - Intronic
1179088836 21:38244776-38244798 GTTCTCCCCTCCCAGGGCTTGGG - Intronic
1180154508 21:45971502-45971524 GTCTCTGCCTCCCAAGGGTGGGG + Intergenic
1180842823 22:18967236-18967258 GTCCCTTCTTCCCAGGGCTTCGG - Intergenic
1181038038 22:20179273-20179295 GTCCCTCCCTCCTGGGGATGGGG - Intergenic
1181058633 22:20271498-20271520 GTCACTGCTTCCCAGGGCTTGGG + Intronic
1181109488 22:20592979-20593001 TTCCCTTCCTCCCTTGGGTTGGG - Intergenic
1182875527 22:33688201-33688223 GTCCCTCCCTCACAGAGCTGTGG + Intronic
1183338375 22:37264146-37264168 GTGGCTGCCACCCAGGGGTTAGG + Intergenic
1183531110 22:38353836-38353858 ATCCCTCCCTTGCAGGAGTTTGG + Intronic
1183592446 22:38787823-38787845 ATCCTTCCCTCACAGGTGTTAGG - Intronic
1184497580 22:44851106-44851128 GTCCTTCCCTCCCCGGGGACTGG - Intronic
1184660017 22:45961374-45961396 GTCCCTCCCCCACAGGTGTAAGG - Intronic
1185383459 22:50521053-50521075 ATCCCTCCCTGCCGGGGGTCAGG - Intronic
950471193 3:13187524-13187546 GTCCCTCTCTCCCACTGGTATGG + Intergenic
950704190 3:14769834-14769856 GCCCCTCCGTCCCAGCAGTTGGG - Intronic
953914041 3:46906643-46906665 GCCCCTCCCTCCCTGGGATCTGG + Intergenic
954390015 3:50263801-50263823 CTCCCTCCCTCCCCTGGGTGGGG - Intergenic
954459939 3:50620619-50620641 GTCCCTCCCTCCCAGGGAGCTGG + Intronic
955044133 3:55343885-55343907 ATTCCTCCCTCCCAGGGTTCAGG - Intergenic
956088306 3:65637133-65637155 GACAGTCCCACCCAGGGGTTGGG + Intronic
961013452 3:123449962-123449984 GCCCCTCCCTCCCTGGGACTAGG + Intergenic
961338087 3:126197004-126197026 GTCTCTGCCTTCCAGGGGATAGG - Intronic
961479471 3:127170848-127170870 GTCCCTGCCTGCCAGGGTCTGGG + Intergenic
961970923 3:130966508-130966530 GTCCCAGCCTCCCAAGTGTTAGG + Intronic
962249380 3:133826095-133826117 GCCCCTCCCTTCCTGGGGTGTGG - Exonic
963034389 3:141012989-141013011 GTACCTCCCTCCCCAGGCTTAGG + Intergenic
963067779 3:141277621-141277643 GTCCACCCCTGCCAGGGGGTGGG + Intronic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
968631305 4:1653527-1653549 GTCCCTGCTTGCCAGGGCTTGGG - Intronic
970483965 4:16505934-16505956 CTCCATCCCTCCCAGGGTTGAGG + Intronic
970526700 4:16939590-16939612 GTCTCTCCCTCCCATGTCTTAGG + Intergenic
970859225 4:20682823-20682845 GCCACTCCCTCCCAGGGCTGGGG + Intergenic
973284839 4:48403592-48403614 CACCCTTCCTCCCAGGAGTTCGG + Intronic
980286561 4:130785551-130785573 TATCCTCCCTCCCAGGGATTAGG + Intergenic
986817651 5:11430133-11430155 GTCCCAGCCTCCCAGGTGTCTGG - Intronic
995458361 5:112375923-112375945 GTCTGTGCCTCCAAGGGGTTAGG + Intronic
997526272 5:134555148-134555170 GTCCCTCCCTCCCTGGCCTTTGG + Intronic
997908478 5:137844326-137844348 ATCCCTCCCTCCCAGAGTGTTGG - Intergenic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1001893891 5:175362458-175362480 GCCCCTCCCACCCAGGGCTCTGG + Intergenic
1001934364 5:175694073-175694095 GGGCCTCCCTCCCAGGGCTGGGG + Intergenic
1004201761 6:13555135-13555157 TTCCCTCCCTCCCATGGGCTGGG - Intergenic
1004983743 6:21057055-21057077 GTCCCTCCTTTCCAGTTGTTTGG + Intronic
1007096974 6:39219278-39219300 GTCCCTCCCTCAAAGGGGAGAGG + Intronic
1012614716 6:101262361-101262383 GTCCCTCCATCCCATGCTTTGGG - Intergenic
1016060489 6:139625097-139625119 TTTCCTGCCTCCCAAGGGTTAGG - Intergenic
1017043178 6:150324163-150324185 GCCTTTCCCTCCCAGGAGTTCGG + Intergenic
1017720614 6:157240904-157240926 CTCCCTCCCTCCCCAGGGCTGGG - Intergenic
1019328736 7:452467-452489 GTCCCTCCCTCCCTGGGGCGTGG - Intergenic
1019408791 7:897773-897795 GGCCCTCGCTCCCTGAGGTTTGG - Intergenic
1019475901 7:1244112-1244134 GTCCCCCTCCCCCAGGGCTTGGG - Intergenic
1019549017 7:1593088-1593110 GTCCGTCCTTTCCAGGGGTCTGG + Intergenic
1019577288 7:1743654-1743676 GTGCCTCCCTCCCAGAGGGCTGG + Intronic
1024567900 7:50697826-50697848 CTCCTTCCCTCCCTGGGGTGGGG - Intronic
1029478799 7:100800930-100800952 GACCCTCCCTTCCCGGGTTTGGG - Intergenic
1034505319 7:151484597-151484619 GTCCCTGACTCCCAATGGTTTGG - Intronic
1034898078 7:154890327-154890349 GTCCCTCCCTCCCACAGGCAGGG - Intronic
1036287746 8:7459656-7459678 ATGCTTCCCACCCAGGGGTTTGG + Intronic
1036333730 8:7851872-7851894 ATGCTTCCCACCCAGGGGTTTGG - Intronic
1037878546 8:22561419-22561441 GTCCGCCCCTCCCTGGGGCTGGG + Intronic
1039561237 8:38514048-38514070 CTCCCTCCCTCCCTGGGCTGGGG + Intronic
1039981914 8:42415331-42415353 TTCCCTCCCTCGCAGGCGATCGG + Intergenic
1040455334 8:47592453-47592475 GTCCCTCCCTCAAAGGGGGAAGG + Intronic
1040563513 8:48545629-48545651 GTTTGTCCCTCCCAGGGCTTGGG + Intergenic
1040811714 8:51461147-51461169 ATCCCACCCTCCCAGGGTCTAGG + Intronic
1041846205 8:62331425-62331447 GTCCCTGCCTTCAAGGAGTTTGG - Intronic
1042025340 8:64416710-64416732 GTCCCTTCCTCACAGGGCTTAGG - Intergenic
1042651071 8:71042020-71042042 GTCCCTCCCTCCCAATGCTATGG - Intergenic
1043138966 8:76564045-76564067 GTCCATCCTTCCCAGGATTTCGG + Intergenic
1044860034 8:96514376-96514398 GTCCCAACCTGCCAGGGGTTTGG + Intronic
1045059097 8:98396691-98396713 GTCACTGCCTCCCAGGGAGTGGG - Intergenic
1045929182 8:107603302-107603324 GTCCCTCCCTAACAAGGGTGTGG + Intergenic
1046599402 8:116298554-116298576 AGCCCTCCTTCCCAGGGGTTCGG - Intergenic
1048214328 8:132481106-132481128 CTCCCTCCTTCCCCGGGGTGGGG + Intergenic
1048956684 8:139543359-139543381 GTCTCTCCCTGCCAGTGGCTGGG - Intergenic
1049163951 8:141115445-141115467 GTCCTGCCCTCCCAGAGCTTGGG - Intergenic
1049600749 8:143506255-143506277 GTCCACCTCTCCCAGGGGTGCGG - Intronic
1049675646 8:143887706-143887728 GCCCCTTCCTCCCAGGGGCTTGG - Intergenic
1053141981 9:35688238-35688260 TTCCCAGCCCCCCAGGGGTTGGG - Intronic
1055302019 9:74891944-74891966 GTCCCTCCCTTCAAGGGAGTGGG - Intergenic
1056155408 9:83830666-83830688 GTCCAACCCTCCCAGGTGATGGG + Intergenic
1056355078 9:85792429-85792451 GTCCAACCCTCCCAGGTGATGGG - Intergenic
1058635741 9:107036733-107036755 GTCTCTCATTCCCAGGTGTTTGG + Intergenic
1059763086 9:117357853-117357875 GTTCATCCCTCCAAAGGGTTAGG - Intronic
1061275710 9:129568679-129568701 GTCCCTCCTTCCCCGGGGCATGG + Intergenic
1061302038 9:129710951-129710973 GGCCCACCCTCACAGGGCTTGGG + Intronic
1061613195 9:131762399-131762421 GTGCCGCCCTCCCAGTGGCTGGG - Intergenic
1061644023 9:131984476-131984498 GTCCCTCCTTCACAGGGATTTGG + Intronic
1061673474 9:132202324-132202346 GTCCCTCCTTCCCAGGGCCCTGG - Intronic
1062067348 9:134535869-134535891 TCCCCTCCCTCTCAGGGGTAGGG - Intergenic
1062153232 9:135032206-135032228 ATCCCTCCCTCCCAGGGCAAGGG - Intergenic
1186230658 X:7450230-7450252 ATCCCTCTCTCCGAGGAGTTTGG + Intergenic
1186779664 X:12900016-12900038 GTCCTTGCCTGCCAGGGATTGGG - Intergenic
1192005425 X:67206901-67206923 GTTTCTCCCTCCCAGGCCTTGGG - Intergenic
1193500116 X:82264658-82264680 GTCCCTCCCTCCCATGTGGGGGG - Intergenic
1195297008 X:103489287-103489309 GTCCCTCCCTCCCAGAGAGCAGG + Intergenic
1200093905 X:153648340-153648362 GGCCCTCCTTCCAGGGGGTTCGG + Intronic
1200747174 Y:6912472-6912494 CTCCCTCACTCCCAGGCATTTGG + Intronic
1202090097 Y:21179969-21179991 GTCCCTTCCTGGCAGGGCTTTGG + Intergenic