ID: 1078452205

View in Genome Browser
Species Human (GRCh38)
Location 11:11448866-11448888
Sequence GCCCCAGTGTGCAAACAGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078452203_1078452205 -3 Left 1078452203 11:11448846-11448868 CCTTCGGGGCTGAGCTCCTGGCC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1078452205 11:11448866-11448888 GCCCCAGTGTGCAAACAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 136
1078452200_1078452205 8 Left 1078452200 11:11448835-11448857 CCACGCGCCGGCCTTCGGGGCTG 0: 1
1: 0
2: 1
3: 17
4: 125
Right 1078452205 11:11448866-11448888 GCCCCAGTGTGCAAACAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 136
1078452201_1078452205 1 Left 1078452201 11:11448842-11448864 CCGGCCTTCGGGGCTGAGCTCCT 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1078452205 11:11448866-11448888 GCCCCAGTGTGCAAACAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078452205 Original CRISPR GCCCCAGTGTGCAAACAGAG AGG Exonic
900799153 1:4726946-4726968 GCCACAGTGAGGACACAGAGGGG - Intronic
901640111 1:10688822-10688844 GCCCCAGTGTGCAAAAGAGGAGG - Intronic
901930149 1:12591961-12591983 GCCCCAGTGTCCTCGCAGAGGGG - Intronic
902299731 1:15493449-15493471 GCCCCAGTGAGGAAACAGATAGG - Intronic
911440604 1:97921168-97921190 GCCCCAGCCTGCAAGCAGAAGGG + Intergenic
915672113 1:157498519-157498541 GCTCCAGATTGCAAACAGATAGG - Intergenic
920509510 1:206540497-206540519 CCCCCAGTGGGCAAACAGCCTGG + Intronic
922367592 1:224880628-224880650 TTCCCAGTGTGCAAACAGGTCGG - Intergenic
924440531 1:244082060-244082082 GCAGCACTGTGCACACAGAGGGG - Intergenic
1063903356 10:10758565-10758587 GTCCCAGTGTCTACACAGAGTGG + Intergenic
1068466722 10:57402853-57402875 GCCCCAGTGTGTATTCTGAGAGG - Intergenic
1069815999 10:71194812-71194834 CCCCAAGTGTTCAAAGAGAGAGG - Intergenic
1069882247 10:71600885-71600907 CCCCCAGTCTGAAAACAGAAAGG - Intronic
1070589779 10:77793652-77793674 CCCCCAGTGTGCCAGCAGTGTGG - Intronic
1070741953 10:78909078-78909100 GCCCCACAGTGGAAAAAGAGAGG + Intergenic
1074595085 10:114856040-114856062 TCCTCAGTGTGGAAACTGAGTGG + Intronic
1076874143 10:133207768-133207790 GAGCCAGTGTGCACACCGAGTGG - Intronic
1078452205 11:11448866-11448888 GCCCCAGTGTGCAAACAGAGAGG + Exonic
1079693988 11:23455799-23455821 GCCACACTGAGCAAAGAGAGTGG + Intergenic
1080943929 11:36950075-36950097 GCCACTGTGTGCAAACTGAAGGG - Intergenic
1081386653 11:42480376-42480398 GCCCCAGTGGGGACACAGTGTGG - Intergenic
1081718828 11:45271453-45271475 GCAGCAGTGTGCATCCAGAGGGG + Intronic
1081938901 11:46923946-46923968 GGGCAAGTGTGAAAACAGAGAGG - Intergenic
1082793496 11:57363787-57363809 GGCCCAGGCTGCAGACAGAGGGG - Intronic
1084566105 11:69930081-69930103 GCCCCAGTGTGCCCACTGAGGGG + Intergenic
1084751647 11:71208169-71208191 GCCCCACTGTGCACCCAGTGTGG + Intronic
1086009202 11:82078446-82078468 GCCCCAGCATGCACACTGAGAGG + Intergenic
1089124802 11:116169324-116169346 GCCACAGTGTGGAAAAAGATGGG + Intergenic
1090560472 11:127926880-127926902 GGCCCAGCGTCCAAGCAGAGTGG + Intergenic
1090756321 11:129794925-129794947 GCCCCAGTGGGGAAACAGTGTGG + Intergenic
1090800533 11:130168775-130168797 GACCAACTATGCAAACAGAGGGG - Intronic
1093757104 12:22864896-22864918 GACCCAGTGAGAACACAGAGAGG + Intergenic
1095108528 12:38264483-38264505 GCCACAGTGTGAAATCAGGGTGG - Intergenic
1096182277 12:49557510-49557532 GCCCCAGTGTCCACACACAGAGG - Exonic
1099801855 12:87467107-87467129 TCTCCAGTTTGAAAACAGAGGGG - Intergenic
1104239197 12:126971092-126971114 TGCTCAGTGTGAAAACAGAGGGG + Intergenic
1105447022 13:20466230-20466252 GCCCCAATCTCCAAACAGAGGGG + Intronic
1107646556 13:42500015-42500037 GCCTCTGTGTGGAGACAGAGAGG - Intergenic
1107893276 13:44932825-44932847 GTCACACTGTACAAACAGAGTGG - Intergenic
1108489330 13:50964794-50964816 GCACCAGTGTGGAAACAGCTTGG - Intronic
1109181194 13:59215995-59216017 GACCCAGTGGGTAAAAAGAGTGG - Intergenic
1111954101 13:94738093-94738115 GCCAAAGTGTGCTGACAGAGGGG + Intergenic
1114092589 14:19302643-19302665 GGCTCAGTGGGCAAAGAGAGGGG + Intergenic
1114567922 14:23646057-23646079 GCCTCAGTATGCATACACAGAGG - Intergenic
1115490119 14:33950779-33950801 TCCCCAGCGTGCAACCAGAGAGG + Exonic
1116216703 14:42025619-42025641 GGCCCAGAGTGCAAACACTGGGG - Intergenic
1117609358 14:57466117-57466139 GACCCACTGAGCAATCAGAGAGG - Intergenic
1126825046 15:52540299-52540321 GCCCCAGTGGGGACCCAGAGTGG + Intergenic
1128979106 15:72174002-72174024 GCTTCAGTGGGCAAACAGAAAGG - Intronic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1130515276 15:84621571-84621593 GCCCTGGTGTGCAATCAGACTGG - Exonic
1130740425 15:86593128-86593150 GCCCCAGTGTGGTCACAGGGAGG + Intronic
1130911445 15:88273690-88273712 GGCTCAGTGTGCAGAGAGAGGGG - Intergenic
1132534534 16:471514-471536 GCCCCACGGTGCACACAGGGCGG - Intronic
1135570501 16:23545526-23545548 GCCTCAGTGTCCTCACAGAGTGG - Intronic
1135653913 16:24231119-24231141 GCCTTACTGTGCACACAGAGTGG + Intergenic
1139833354 16:69818771-69818793 TCCCCAGTCTGCAAACATGGGGG + Intronic
1141570856 16:84932850-84932872 GCCACACTGTGCATTCAGAGGGG - Intergenic
1143023509 17:3928548-3928570 TCCCCGATGTGCAGACAGAGAGG + Intronic
1152091981 17:78252219-78252241 ACCCGAGTGTGCAAGCACAGCGG - Intergenic
1152332355 17:79680543-79680565 GCATCAGTGAGCAAGCAGAGGGG - Intergenic
1152367251 17:79863404-79863426 GTCCCAGGATGCCAACAGAGAGG + Intergenic
1152539504 17:80967833-80967855 GCCCCGCTGCGCACACAGAGGGG + Intergenic
1152560404 17:81075784-81075806 GCCCCAATGTGCCCACGGAGGGG - Intronic
1153839772 18:8996296-8996318 GGGTCAGTGGGCAAACAGAGGGG + Intergenic
1156312134 18:35934374-35934396 GCCCCAGTGTGCAAGAATAGTGG + Intergenic
1156592630 18:38508961-38508983 TCAGCAGTGTGCAAACACAGGGG - Intergenic
1159631497 18:70753795-70753817 GCCACTGTGTGCAAACAAGGAGG - Intergenic
1161778273 19:6275634-6275656 GCCCCAGTGTGCCAGCAGTCAGG - Intronic
1163010089 19:14419533-14419555 GCCCCAGTGAGCCGACAGACTGG + Intergenic
1163481765 19:17560699-17560721 ACCCAAGTGTCCAAACACAGGGG - Intronic
1164694803 19:30235202-30235224 TCCGCAGTGGGCAAACTGAGGGG + Intronic
1167061793 19:47153386-47153408 GCCTCAGTGTTCAAAATGAGAGG - Intronic
925598232 2:5579537-5579559 GCCACAGTAATCAAACAGAGTGG + Intergenic
926308231 2:11655695-11655717 GACTCTGTGTGCACACAGAGAGG + Intergenic
931367985 2:61636029-61636051 GGCCCAGTGTGAAAACAAAGAGG - Intergenic
935123847 2:100205484-100205506 GCCCCACTCTCCAAACATAGAGG - Intergenic
939737428 2:145865829-145865851 CCCACAGTGTGCAAAAAGAGAGG - Intergenic
941001086 2:160204635-160204657 GTCCCAAGGTGCAAACAGAGTGG - Intronic
941622373 2:167792769-167792791 GCCCCAGCCTGCAGACAGGGAGG + Intergenic
947543001 2:230991290-230991312 GCCCCAGTGAGCACACCGGGAGG - Intergenic
947669699 2:231928493-231928515 GCCTCAAAGTTCAAACAGAGAGG - Intergenic
948001061 2:234567796-234567818 GCCCCAGGATGCACACAGAGAGG - Intergenic
948188970 2:236044013-236044035 TGCCCAGTGAGCAGACAGAGGGG - Intronic
948236418 2:236394324-236394346 GCTCCAGTTTTCAAAAAGAGTGG + Intronic
1169324929 20:4668015-4668037 GCCCTAGTGTGCAAAGGCAGAGG - Intergenic
1169859121 20:10132973-10132995 TCCCCAGTGTTCATAGAGAGAGG + Intergenic
1170413982 20:16120742-16120764 GCAACTGTGTGCAAACAGCGTGG - Intergenic
1172028581 20:31966547-31966569 GCCCAAGGCTGAAAACAGAGGGG - Intergenic
1174840602 20:53898050-53898072 ACCCCAGCATGCAAACAGATTGG + Intergenic
1175284767 20:57830685-57830707 GCCCCAGTGGTCAGGCAGAGAGG + Intergenic
1175739047 20:61407705-61407727 GCCCAAGTGTGCATACCTAGAGG + Intronic
1178623681 21:34198324-34198346 GCCACAGTGTGAGAACCGAGGGG - Intergenic
1180488140 22:15819923-15819945 GGCTCAGTGGGCAAAGAGAGGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181457817 22:23069853-23069875 GCCCCACTTTGCAAACAGAAAGG + Intronic
1184833009 22:47002396-47002418 GCCCCAGAATTCACACAGAGGGG - Intronic
1185202741 22:49518008-49518030 GCCACAGCGTGCAAGCACAGCGG + Intronic
951909222 3:27731543-27731565 GCCCCAGCTGGCAAGCAGAGCGG - Intergenic
956057749 3:65318437-65318459 GCTCCAGTGAGCCAACAGCGAGG - Intergenic
957193775 3:77041464-77041486 TCCCCAGTGGGCAAACACAATGG + Intronic
957804066 3:85124078-85124100 GCCCCAATTAGCAAACACAGGGG - Intronic
961274363 3:125715641-125715663 GTCCCAGGGTGTGAACAGAGGGG + Intergenic
961554425 3:127688477-127688499 GCCTCCGTGTGGAAACAGACTGG + Intergenic
963046032 3:141103330-141103352 GGCACAGTGTGGACACAGAGGGG + Intronic
969369206 4:6720570-6720592 CTCCCAGTGTGCAGACAGAGTGG + Intergenic
982609403 4:157554419-157554441 GACACAATGTGCTAACAGAGGGG + Intergenic
983630230 4:169842418-169842440 GCCTCAGTGCTCAAACACAGTGG - Intergenic
985848899 5:2374205-2374227 GCCCTCGTGGGCACACAGAGGGG - Intergenic
986191135 5:5497121-5497143 GCCCGAGTGAGCAAAGAGAAAGG + Intergenic
993000922 5:82379781-82379803 GCCCCAGTGGGGAATCAGTGTGG + Intronic
995741040 5:115356010-115356032 GACACTGTGTGTAAACAGAGAGG + Intergenic
996396919 5:123022577-123022599 GGCCCAGGTTGGAAACAGAGTGG - Intronic
1002314085 5:178332095-178332117 ACCCCAGGGTGCAAAGTGAGTGG + Intronic
1011681501 6:89787817-89787839 GCTCCAGAGTGAAAACAGAAAGG + Intronic
1013316105 6:108944736-108944758 GGGCCATTATGCAAACAGAGGGG - Intronic
1015568021 6:134594044-134594066 GGCCCAGTGTGGAGACAGACAGG + Intergenic
1016275589 6:142348525-142348547 GCTTCAGTGTGAATACAGAGTGG + Intronic
1017027335 6:150192842-150192864 GACACTGTGTGGAAACAGAGAGG - Intronic
1018215408 6:161521753-161521775 GCCCCAGTAATCAAACTGAGAGG - Intronic
1018982774 6:168613346-168613368 GCACCAGTGTGAGGACAGAGGGG + Intronic
1019914364 7:4123212-4123234 GTCCCTGTCTGCAAAAAGAGAGG - Intronic
1019922509 7:4171965-4171987 ACCCCAGTGAGCAAACCCAGGGG - Intronic
1022440186 7:30426737-30426759 GCCCCAGGGTTCAGACAGTGTGG - Intronic
1026232105 7:68493804-68493826 GTCCAAGTGTGCAAACAGGATGG - Intergenic
1033049425 7:137990586-137990608 TCCCCAGGATGCAAACAGACAGG + Intronic
1034190143 7:149207554-149207576 GCCCCATGGTGCACACACAGTGG - Intronic
1035182470 7:157099362-157099384 GCCCCAGTATTCCTACAGAGAGG + Intergenic
1035340357 7:158156919-158156941 TCCCCATTGTGCTAACACAGCGG + Intronic
1035340369 7:158156976-158156998 TCCCCATTGTGCTAACACAGTGG + Intronic
1035582511 8:748429-748451 GCCCCTGGGTGGGAACAGAGTGG + Intergenic
1036786340 8:11690199-11690221 TCCACTGTGTGCAAACACAGAGG - Intronic
1037479347 8:19289612-19289634 TCACCAGTGTGCAAGCAGGGTGG - Intergenic
1037805741 8:22057164-22057186 GGCCCAGAGTGCCCACAGAGGGG - Intronic
1037984018 8:23275526-23275548 GCCCCAGTGTGGCCACAGACAGG + Intronic
1038732361 8:30138873-30138895 GCCCCAGAGTGCAAACAGCATGG - Intronic
1041040462 8:53841374-53841396 GCCCTAGTGGGGAAGCAGAGCGG - Intronic
1048043298 8:130751013-130751035 GCCCCAGTGGGGAAACTGTGTGG + Intergenic
1051716909 9:19994637-19994659 GCCCAAGTTGGCAAGCAGAGTGG + Intergenic
1056035537 9:82600987-82601009 GCCCCACTATCCAAACAGAGTGG + Intergenic
1056488266 9:87080812-87080834 GCCCCTGTGTGGCCACAGAGTGG + Intergenic
1057050843 9:91922893-91922915 GCCCCAGTGTGCACCCAGAAAGG - Intronic
1057784704 9:98078043-98078065 GCCCCTGTGGGGGAACAGAGAGG - Intronic
1057843776 9:98506537-98506559 GACCCAGTCTGCAGACACAGGGG + Intronic
1058428816 9:104900051-104900073 CCCCCATTGTGCAGACTGAGGGG - Intronic
1059540951 9:115129768-115129790 GCCACAGAGTGCATTCAGAGGGG + Intergenic
1062321282 9:135991540-135991562 GCCCCTGTGTGCAAAGTAAGTGG + Intergenic
1186626098 X:11295485-11295507 GCACCTGTGTCCAGACAGAGTGG - Intronic
1190581397 X:51895038-51895060 GCCTCAGCCTGCAAACACAGGGG - Exonic
1192223777 X:69214906-69214928 GCCCCTCTGGGGAAACAGAGAGG + Intergenic
1196025030 X:111033119-111033141 GCCCCTGTGTGTACAGAGAGAGG - Intronic
1199833180 X:151563664-151563686 GCCCCAGAGTGCAAAGCGCGTGG - Exonic
1200388482 X:155918090-155918112 CCCTCACTGTGTAAACAGAGTGG - Intronic