ID: 1078453029

View in Genome Browser
Species Human (GRCh38)
Location 11:11454399-11454421
Sequence CAGTCCTATTCTGGATACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078453029_1078453035 14 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453035 11:11454436-11454458 ACCCCCAAAATATAGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 166
1078453029_1078453042 27 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882
1078453029_1078453034 8 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453034 11:11454430-11454452 GTAATTACCCCCAAAATATAGGG 0: 1
1: 0
2: 2
3: 19
4: 160
1078453029_1078453043 30 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453043 11:11454452-11454474 GAGAAGGAAGATAAGGAGGGAGG 0: 1
1: 2
2: 37
3: 719
4: 4794
1078453029_1078453040 23 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453040 11:11454445-11454467 ATATAGGGAGAAGGAAGATAAGG 0: 1
1: 0
2: 1
3: 47
4: 559
1078453029_1078453033 7 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453033 11:11454429-11454451 AGTAATTACCCCCAAAATATAGG 0: 1
1: 0
2: 0
3: 17
4: 145
1078453029_1078453041 26 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453041 11:11454448-11454470 TAGGGAGAAGGAAGATAAGGAGG 0: 1
1: 0
2: 9
3: 110
4: 1199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078453029 Original CRISPR CAGTCCTATTCTGGATACTT GGG (reversed) Intronic
900466616 1:2828743-2828765 CAGGCCCATTCTGTGTACTTGGG - Intergenic
902166488 1:14576028-14576050 CACTCCTAACCTGGATGCTTTGG - Intergenic
902217409 1:14943310-14943332 CAATCCTAATCTGGAGGCTTGGG - Intronic
902604889 1:17563567-17563589 AAGTCCTGTTCTGAGTACTTGGG - Intronic
905451613 1:38060559-38060581 CAGTCCTAGCCTGTAAACTTTGG + Intergenic
907423901 1:54366395-54366417 CATTCCTCATCTGTATACTTGGG - Intronic
909057731 1:70842818-70842840 TAGTTCTATAATGGATACTTTGG - Intergenic
909292015 1:73895293-73895315 CAGGCCTTTGCAGGATACTTTGG + Intergenic
909990143 1:82213373-82213395 CAGTCATAATTTAGATACTTAGG - Intergenic
912060059 1:105657258-105657280 CAGGCCTCTTCTGGACATTTGGG - Intergenic
913400994 1:118432794-118432816 CAATTCTACTCTGGATATTTAGG + Intergenic
916377724 1:164173633-164173655 CAGTCCTATTCTGGCTACTGCGG - Intergenic
919619406 1:199847979-199848001 CAGTTCTATTGAGGATGCTTTGG - Intergenic
922321151 1:224488574-224488596 CAGTCCTATTCAGGAGGCTGAGG - Intronic
922357221 1:224787897-224787919 CATTTTTATTCTGGATAATTGGG - Intergenic
922630973 1:227110642-227110664 CAGCACTATTCTGGGTGCTTTGG - Intronic
923681694 1:236123830-236123852 CAGTCACATTCTGGGTACTGCGG - Intergenic
1065866639 10:29920390-29920412 AATTCCTCTTCTGTATACTTAGG + Intergenic
1065975921 10:30842315-30842337 CAGTCCCAACCTGTATACTTAGG - Intronic
1066516963 10:36173208-36173230 TAGTGCTACTTTGGATACTTAGG - Intergenic
1069868769 10:71520594-71520616 CAGCCCTGTTCTGGACACTCAGG - Intronic
1070629078 10:78071583-78071605 CAGTCCTATTTTGGAGAAGTTGG + Intergenic
1071009633 10:80922950-80922972 CAGTCTGATTCTTGATACTTCGG - Intergenic
1073655417 10:105410319-105410341 CAGTTCTTTACTGAATACTTTGG + Intergenic
1073671420 10:105594395-105594417 CAGTATTATTCTGGACACTGCGG - Intergenic
1076637658 10:131892762-131892784 CAGTGCCATTCTGGACACTTGGG + Intergenic
1078453029 11:11454399-11454421 CAGTCCTATTCTGGATACTTGGG - Intronic
1085274714 11:75291023-75291045 CAGTGCTGTTCTGGGTGCTTGGG - Intronic
1086327699 11:85720921-85720943 CAGTCCTGTTTTGAAAACTTTGG - Exonic
1088379442 11:109177073-109177095 CTGGCATATTCTGGATATTTTGG + Intergenic
1088877446 11:113947723-113947745 CAGTCATATTCTGAGTACTAGGG + Intergenic
1090601410 11:128375908-128375930 CAGGCCTATTCTGAGTACTGGGG + Intergenic
1100059869 12:90561638-90561660 CAGTCATATTCCCTATACTTAGG - Intergenic
1100214088 12:92429474-92429496 CAGTCACATTCTGGTTTCTTGGG - Exonic
1101185490 12:102272570-102272592 CTGTCTTATTCTGTAAACTTAGG + Intergenic
1102776425 12:115523668-115523690 CAGTCCTATTCTGTATGAGTGGG + Intergenic
1104226511 12:126839642-126839664 CAGTCTCATTCAGGATACATGGG + Intergenic
1109191227 13:59326752-59326774 AAGTACTATTCTGGAAACTGTGG + Intergenic
1111922375 13:94425780-94425802 CAGGACTATTCTGGAAGCTTAGG - Intergenic
1112211806 13:97385184-97385206 CAGCCCTATCCTAGATACTGGGG + Intronic
1116759828 14:48998450-48998472 CAGCCATGTTCTAGATACTTGGG + Intergenic
1116867641 14:50044052-50044074 GAGTCCTAATTTGGATAATTTGG + Intergenic
1120391023 14:83908849-83908871 CAGAAGTGTTCTGGATACTTGGG + Intergenic
1121392420 14:93587595-93587617 CATTCTTGTTCTGGGTACTTAGG + Intronic
1121976515 14:98409024-98409046 CAGTTCTATTCTTGACACTGGGG - Intergenic
1126147429 15:45489170-45489192 CAGTACTGTTCTAGGTACTTGGG + Intronic
1131458567 15:92602488-92602510 AAGTCCTATTCTGGGCACTGAGG - Intergenic
1131525448 15:93148872-93148894 CAGTCCTCTGATGGACACTTAGG + Intergenic
1133340297 16:5031614-5031636 CAGCACTATTCTGGGTACTGGGG - Intronic
1139546220 16:67650966-67650988 CCTTCCTATTCTGGGCACTTAGG + Intronic
1149046939 17:52256837-52256859 CAGTCTAATGGTGGATACTTGGG + Intergenic
1149066448 17:52486081-52486103 GATTCCCATTCTGCATACTTGGG + Intergenic
1203157436 17_GL000205v2_random:17771-17793 CAGGCTTATTCTGGAAACTTCGG + Intergenic
1155135955 18:22993072-22993094 CAGTCCTATTCTGTTCACCTAGG - Exonic
1155469635 18:26177558-26177580 GAGTACTAATCTGGATATTTAGG + Intronic
1156648794 18:39199781-39199803 CAGCCCTGTCCTGGATACTTTGG + Intergenic
1157093355 18:44662169-44662191 CTGTCCTACTCTGGTTACTAGGG - Intergenic
1166063086 19:40339630-40339652 CATTCCTATTCTATAGACTTTGG - Intronic
926526678 2:13990332-13990354 CAGTCCAATTTTGGAAACTGAGG - Intergenic
926859592 2:17294324-17294346 CATTTGTATTCTGCATACTTTGG - Intergenic
927593337 2:24375560-24375582 GAGTACTACTCTGGCTACTTGGG + Intergenic
933616229 2:84484962-84484984 CAGTCCTGTTCTGAGTGCTTCGG + Intergenic
934558394 2:95299533-95299555 CATTCCTATTCTAGACACTGAGG + Intronic
934666794 2:96177357-96177379 GAGTCCTATTCCGGACACTGAGG + Intergenic
935493721 2:103752532-103752554 CAGTTTTATTCTGGACATTTTGG - Intergenic
938871210 2:135478776-135478798 CAGTCCTATTCATAATAGTTAGG - Intronic
941106546 2:161360650-161360672 CAGCCCTATTCTGGGTAGTTGGG + Intronic
942443991 2:176066437-176066459 CTGTCCTTTTCTGGATAATGGGG - Intergenic
945637662 2:212376602-212376624 CAGTCCTGATCTGGCTCCTTTGG + Intronic
1168943973 20:1736034-1736056 CAGTGCTATTCTGGGTTCCTGGG + Intergenic
1169344665 20:4820910-4820932 CAGTCCTCTTTAGGATATTTTGG - Intronic
1170264730 20:14452721-14452743 CAATCCTATTGTGAATCCTTTGG + Intronic
1176975398 21:15315139-15315161 CAGTTCTATTCTTAATACTCAGG + Intergenic
1178580236 21:33831998-33832020 CTGTCCTGTTCTGGAGACGTGGG + Intronic
950534339 3:13570614-13570636 CAGTCCTATTTTGTGGACTTCGG + Exonic
952660393 3:35839645-35839667 CACTTCTACTCTGTATACTTGGG - Intergenic
953446065 3:42968622-42968644 CAATCCAATTTTGGATACATGGG - Intronic
954962852 3:54581226-54581248 GGGTCCTATTCTGGATATTCTGG + Intronic
961617723 3:128196460-128196482 CAGACCTATTTTAGAAACTTTGG + Intronic
964092883 3:152896609-152896631 CAATCCTCTTCTGCATACTTTGG + Intergenic
966478943 3:180383135-180383157 CAGTCCTAATCTAGATTCTAGGG + Intergenic
966841150 3:184088810-184088832 AAGGACTATGCTGGATACTTTGG - Intergenic
969938041 4:10702429-10702451 CAGTCCTATTTTGGATATTTAGG + Intergenic
974407408 4:61492377-61492399 CAATCATATTCAGTATACTTTGG + Intronic
974976551 4:68901223-68901245 CAGCCCTATTCTGGTCACTCCGG - Intergenic
977606146 4:98986866-98986888 CAGCCTTATTCTGGGTACTAGGG + Intergenic
978898677 4:113923124-113923146 CAGGCCTATCCTGTATATTTTGG + Intronic
982418047 4:155160309-155160331 CAGTCCTGTTCTGAAGCCTTGGG - Intergenic
988430015 5:31108779-31108801 CAGTCCTAGTGTTGCTACTTAGG + Intergenic
988687545 5:33539663-33539685 CAGTATGTTTCTGGATACTTCGG - Intronic
988971168 5:36469409-36469431 CACTCCTATTCGGCATAGTTAGG + Intergenic
990697726 5:58439956-58439978 CAGTCATATTTTGCATGCTTTGG + Intergenic
992847701 5:80769608-80769630 CAGTCCTATTCTGGGTCTTGAGG + Intronic
994578278 5:101609043-101609065 CAGTCCTATCTGGGATATTTAGG - Intergenic
997800335 5:136854345-136854367 CAGAGCTAATCTGTATACTTGGG - Intergenic
1000420725 5:161035235-161035257 TCATCCTATTCTGGATACTGAGG - Intergenic
1003820903 6:9895873-9895895 CAGTTCTATGCTGGATACTTGGG + Intronic
1004749095 6:18542365-18542387 CAGTTCTATTTTGGAAAATTTGG - Intergenic
1004986913 6:21092652-21092674 CATTCCTATTCTGTTTGCTTTGG - Intronic
1008077710 6:47163085-47163107 GAGATATATTCTGGATACTTTGG - Intergenic
1008259258 6:49344549-49344571 AAGTCCTATACTTGAAACTTGGG + Intergenic
1008784783 6:55154652-55154674 AAGTCCTAGTCTGGACAATTGGG + Intronic
1011719054 6:90136257-90136279 CAGTTCTATTATGGATAAATAGG + Intronic
1012617133 6:101291121-101291143 CAGTCACATTCTGGGTACTAGGG - Intergenic
1013989388 6:116236039-116236061 CAATCCTATGCTGGATACAGAGG - Intronic
1017436144 6:154417600-154417622 CAGTCACATTCTGGGTACTGGGG - Intronic
1017999972 6:159570284-159570306 CAGTCATATTCTGGACACTTTGG - Intergenic
1018000189 6:159572071-159572093 CAGTCCTACCCTGGATACTCTGG + Intergenic
1018999707 6:168739311-168739333 CAGCCTTATTCTAGATACCTAGG - Intergenic
1021663202 7:22942688-22942710 AAATATTATTCTGGATACTTAGG + Exonic
1023114185 7:36844716-36844738 CAGTCATATTTTGAAAACTTTGG + Intergenic
1023623683 7:42096294-42096316 GCGTCCTATTCTGGATTCTAGGG - Intronic
1028795802 7:94901920-94901942 AAGTCATATTCTCCATACTTGGG + Intergenic
1028872683 7:95786523-95786545 CAGTGCTGTTCTGGGTACTGTGG - Intronic
1029885777 7:103869864-103869886 AAGTCCTATTCTTCATATTTTGG + Intronic
1030600115 7:111583204-111583226 CAATTATATTCTGGATATTTTGG + Intergenic
1030720169 7:112861911-112861933 CCATCCTATTCTAAATACTTTGG + Intronic
1031630854 7:124041203-124041225 GATTGCTAATCTGGATACTTTGG + Intergenic
1032855066 7:135827308-135827330 CTGTCTTTTTCTGGAGACTTTGG + Intergenic
1033835128 7:145301090-145301112 CCTTCCTATTCTGTATTCTTTGG + Intergenic
1034982020 7:155485176-155485198 CAGCCCTGCTCTGGATACCTTGG - Intronic
1036003151 8:4631618-4631640 CAGTTTTATTGTGGATAGTTAGG - Intronic
1038110804 8:24495208-24495230 CATTTGTATTCTGGATACTCTGG - Intronic
1038625975 8:29193613-29193635 CAGTCCCACTCAGGATACTGAGG - Intronic
1040633688 8:49247021-49247043 CAGTCCAATTCTTGCTTCTTTGG + Intergenic
1043549426 8:81353164-81353186 CAGAGCTTTTCTGGTTACTTTGG + Intergenic
1045982432 8:108206397-108206419 CAGTTCTAATCTGGAGATTTGGG + Intronic
1048930614 8:139312669-139312691 CTGTCATATTCTTGATAGTTAGG + Intergenic
1050032877 9:1404865-1404887 CAGTCATATTCTGGAATCCTGGG + Intergenic
1052158189 9:25221500-25221522 CAGTCCTTTTTTCCATACTTTGG + Intergenic
1055070428 9:72160441-72160463 CTTGCCTATTCTGGATATTTCGG + Intronic
1061907484 9:133706105-133706127 CAGTTCTCTTGTGCATACTTGGG - Intronic
1062077960 9:134602370-134602392 CAGTTTTATTCTGGGGACTTGGG + Intergenic
1062330540 9:136041536-136041558 GATTCCTATTCTGGGCACTTTGG - Intronic
1186532026 X:10306612-10306634 CAGTCATCTGCTGGATACTTAGG + Intergenic
1186565022 X:10653073-10653095 TAGTGCTATTCTGGATGCTGAGG - Intronic
1187340675 X:18418919-18418941 CAGTTCTATCCTAGATACTGGGG + Intergenic
1189018709 X:37311882-37311904 AAGTCCTCTTCTGATTACTTAGG - Intergenic
1193158449 X:78200052-78200074 CAGCCCTCTACTGGACACTTAGG + Intergenic
1193327512 X:80196780-80196802 CCGTCATATTCTGATTACTTTGG + Intergenic
1196126450 X:112105883-112105905 AAGTCCTAGTCTGAATAGTTAGG - Intergenic
1196233996 X:113257925-113257947 CACTCCTATTCAGCATACTGTGG - Intergenic