ID: 1078453030

View in Genome Browser
Species Human (GRCh38)
Location 11:11454400-11454422
Sequence ACAGTCCTATTCTGGATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078453030_1078453041 25 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453041 11:11454448-11454470 TAGGGAGAAGGAAGATAAGGAGG 0: 1
1: 0
2: 9
3: 110
4: 1199
1078453030_1078453043 29 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453043 11:11454452-11454474 GAGAAGGAAGATAAGGAGGGAGG 0: 1
1: 2
2: 37
3: 719
4: 4794
1078453030_1078453033 6 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453033 11:11454429-11454451 AGTAATTACCCCCAAAATATAGG 0: 1
1: 0
2: 0
3: 17
4: 145
1078453030_1078453034 7 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453034 11:11454430-11454452 GTAATTACCCCCAAAATATAGGG 0: 1
1: 0
2: 2
3: 19
4: 160
1078453030_1078453035 13 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453035 11:11454436-11454458 ACCCCCAAAATATAGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 166
1078453030_1078453040 22 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453040 11:11454445-11454467 ATATAGGGAGAAGGAAGATAAGG 0: 1
1: 0
2: 1
3: 47
4: 559
1078453030_1078453042 26 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078453030 Original CRISPR ACAGTCCTATTCTGGATACT TGG (reversed) Intronic
904566203 1:31429751-31429773 ACAGCCCTTTCCTGCATACTGGG + Intronic
906514336 1:46429954-46429976 ACAGTGATACTCTGAATACTTGG + Intergenic
907423902 1:54366396-54366418 ACATTCCTCATCTGTATACTTGG - Intronic
907608660 1:55845348-55845370 AAAGTTCTATTCTGGATAGAGGG - Intergenic
908331249 1:63073507-63073529 ACACTCCTATTATGCATACGAGG - Intergenic
908816509 1:68040933-68040955 AGTGTCCTATTCAGGATACACGG + Intergenic
913072651 1:115314733-115314755 AAAGCACTATTCTAGATACTGGG + Intronic
916499243 1:165372769-165372791 CAAGTCATATTCTGGATACCTGG - Intergenic
917542526 1:175928357-175928379 ACAGTCCTGTTCTCTGTACTTGG + Intergenic
918949147 1:191112649-191112671 ACAGTCCTCTTTTGGACAGTAGG - Intergenic
919505139 1:198388851-198388873 GCACATCTATTCTGGATACTGGG + Intergenic
921602206 1:217118236-217118258 ACAGTCTGATTCTGAATCCTGGG + Intronic
922357222 1:224787898-224787920 ACATTTTTATTCTGGATAATTGG - Intergenic
924094482 1:240537091-240537113 ACAGGTCTATTCTGGCTTCTGGG - Intronic
1063873181 10:10442345-10442367 ACAGTAGAATTGTGGATACTGGG + Intergenic
1065366497 10:24942367-24942389 ACAGCACTATTATGGAGACTTGG - Exonic
1067796079 10:49323210-49323232 ACAGGCCATTTCTGGATTCTTGG - Exonic
1069250874 10:66265181-66265203 ACAAACCTATTATGGTTACTTGG + Intronic
1076637657 10:131892761-131892783 TCAGTGCCATTCTGGACACTTGG + Intergenic
1078453030 11:11454400-11454422 ACAGTCCTATTCTGGATACTTGG - Intronic
1080079160 11:28194043-28194065 ACAGAGCTATTTTGGAGACTGGG - Intronic
1081449461 11:43157974-43157996 TCTGTCTTATTCTGGATAGTAGG + Intergenic
1083512873 11:63227809-63227831 AAACTCATATTCTGGACACTGGG + Intronic
1084679120 11:70655713-70655735 ACAGTCCTAGTCTTAAGACTAGG + Intronic
1085661464 11:78371190-78371212 AAAGTTCTATTCTGTATACAAGG - Intronic
1088877445 11:113947722-113947744 ACAGTCATATTCTGAGTACTAGG + Intergenic
1089768109 11:120783177-120783199 ACAATCCTATTCTGCCGACTTGG - Intronic
1090601409 11:128375907-128375929 CCAGGCCTATTCTGAGTACTGGG + Intergenic
1094121034 12:26974402-26974424 ACAGTCTTATTTTTGAAACTAGG + Intronic
1094348005 12:29492477-29492499 AAAGTACTATTCTGGCCACTGGG + Intronic
1097422679 12:59399766-59399788 ACAGTTCTGTTCTGGAGGCTGGG - Intergenic
1098572446 12:72003921-72003943 ACAATCCTATTTTAGATATTTGG + Intronic
1100217964 12:92472523-92472545 AGAGACATATTCTGGATTCTGGG + Intergenic
1104218588 12:126759716-126759738 ACAGACCTATACTTGAGACTAGG + Intergenic
1104240179 12:126980837-126980859 ACATTCCTGTTCTGTATAGTGGG + Intergenic
1106151763 13:27110741-27110763 ACAGATTTATACTGGATACTGGG - Intronic
1106945876 13:34827491-34827513 CCAGTGCTATGCTGGAGACTGGG - Intergenic
1112211805 13:97385183-97385205 CCAGCCCTATCCTAGATACTGGG + Intronic
1114599073 14:23939807-23939829 ACAGTCTTCTTCTGGACAATGGG - Intergenic
1115049195 14:29035764-29035786 ACAGTCACATTCTAGGTACTGGG - Intergenic
1120339095 14:83195780-83195802 GCAGTCCTCTTCTGAATATTTGG - Intergenic
1121976516 14:98409025-98409047 CCAGTTCTATTCTTGACACTGGG - Intergenic
1121977531 14:98419551-98419573 ACACTCCTATTTTGGGTTCTTGG - Intergenic
1125047365 15:35257669-35257691 ACAGTCTTATTCTGGATTGAAGG + Intronic
1129429377 15:75487739-75487761 ACAGTCCTATCCAGGACCCTTGG - Intronic
1133340298 16:5031615-5031637 CCAGCACTATTCTGGGTACTGGG - Intronic
1136742318 16:32547423-32547445 ACAGTCCTTTTGTAGATTCTGGG + Intergenic
1141287466 16:82685867-82685889 ACAGTCCTCTTTTTGATACGTGG + Intronic
1203027281 16_KI270728v1_random:527806-527828 ACAGTCCTTTTGTAGATTCTGGG - Intergenic
1203044440 16_KI270728v1_random:806625-806647 ACAGTCCTTTTGTAGATTCTGGG + Intergenic
1143831075 17:9651719-9651741 ACAGTGATATACTGGAGACTTGG + Intronic
1145019964 17:19422183-19422205 ACAGTCCAATTCTGAATTTTTGG + Intergenic
1149046938 17:52256836-52256858 ACAGTCTAATGGTGGATACTTGG + Intergenic
1157093356 18:44662170-44662192 CCTGTCCTACTCTGGTTACTAGG - Intergenic
1157250425 18:46090885-46090907 ACAGTACTGTTCTAGACACTTGG + Intronic
1160048954 18:75413704-75413726 CCAGTCATATTCTAGAGACTGGG - Intronic
1160519401 18:79495388-79495410 ACAGTCCAATTTTGTGTACTTGG + Intronic
1166667074 19:44686919-44686941 ACAGCCCTATTCTAGGTTCTGGG + Intergenic
926490908 2:13525465-13525487 AAATTCTTATTCTGCATACTGGG - Intergenic
927418023 2:22899545-22899567 ACAGTCCTATTCTGCATTACTGG + Intergenic
927593336 2:24375559-24375581 AGAGTACTACTCTGGCTACTTGG + Intergenic
933849456 2:86354040-86354062 ACAGTCCATTTTTGGCTACTGGG - Intergenic
936083405 2:109450591-109450613 ACAATAATATTCTGGATATTGGG - Intronic
937105234 2:119306107-119306129 ACAGTGATAATCTGGTTACTCGG - Intronic
938578772 2:132627680-132627702 ACAGTGCTGTTTTGGAAACTGGG + Intronic
938603903 2:132872634-132872656 ACAGTCCTCTCCTGGCTAGTGGG + Intronic
938605581 2:132889338-132889360 ACAGTCATATTCAGGAAACGAGG + Intronic
939618422 2:144387414-144387436 ACATTCATATTCTGAATATTAGG + Intergenic
940640124 2:156335421-156335443 AAAGTCCTATTCTGGTTTCTGGG + Intronic
941106545 2:161360649-161360671 CCAGCCCTATTCTGGGTAGTTGG + Intronic
942443992 2:176066438-176066460 GCTGTCCTTTTCTGGATAATGGG - Intergenic
943137261 2:183929503-183929525 ACAGTCACATGCTGGATACTGGG - Intergenic
945753758 2:213820438-213820460 CCAGTCCTAATTTGAATACTTGG - Intronic
1172880483 20:38196497-38196519 CCAGTCCTGTTCAGGAGACTTGG + Intergenic
1174002477 20:47384942-47384964 GCAGTACTATTCTGGGTGCTGGG + Intergenic
1182784600 22:32896971-32896993 AAAGTCCTTTTCTGGAGACCAGG - Intronic
949521995 3:4865392-4865414 ACTGTACTATTTTGGATAATGGG - Intronic
950662783 3:14477071-14477093 ACAGGCCAATTCTGGACACAAGG + Intronic
952413381 3:33068985-33069007 ACAGCCCCTTCCTGGATACTTGG + Intronic
954368933 3:50160249-50160271 ACAGTCCCCTCCTGGATTCTAGG - Intronic
961027814 3:123575533-123575555 ACAGTGCTAGTCTGAAAACTTGG + Intronic
964461370 3:156933735-156933757 ACAGTCCTAAAATGGATAGTTGG - Intronic
964544887 3:157822886-157822908 ATCGTCCTAATCTGGGTACTGGG - Intergenic
964761447 3:160138197-160138219 ACAGTCCTGTTCTTGCTTCTGGG - Intergenic
966478942 3:180383134-180383156 CCAGTCCTAATCTAGATTCTAGG + Intergenic
972328484 4:38041073-38041095 AGAGTCCAATTATGGATAATTGG + Intronic
976426216 4:84906068-84906090 ACAGACATATTCTGTCTACTTGG - Intronic
977606145 4:98986865-98986887 CCAGCCTTATTCTGGGTACTAGG + Intergenic
979857650 4:125653388-125653410 TCATTCCACTTCTGGATACTGGG + Intergenic
980453027 4:132999712-132999734 ACAGTCTTCTTCAGGATAGTAGG - Intergenic
981491440 4:145344569-145344591 ACAGTCCTATTCTTGTCAATAGG - Intergenic
981981262 4:150793574-150793596 ACAGTACTATACTGGACGCTGGG + Intronic
982418048 4:155160310-155160332 ACAGTCCTGTTCTGAAGCCTTGG - Intergenic
982585945 4:157239200-157239222 ACAGTTCTATTCTGGACATAAGG - Intronic
984946085 4:184969681-184969703 GCATTTCTATTTTGGATACTGGG + Intergenic
985005302 4:185529191-185529213 CCAGTCCTATTCCAGATGCTCGG + Intronic
986420205 5:7572897-7572919 ATAGTCCTATTATGGGGACTAGG - Intronic
992883349 5:81132199-81132221 ACAATACTATTCTAGATATTGGG - Intronic
995058693 5:107790685-107790707 GCAGTCCTAGTTTGGATGCTTGG + Intergenic
997687705 5:135800241-135800263 ACTCTCCTTTTCTGGATATTAGG - Intergenic
1003079664 6:3011162-3011184 AAAGTGCTATTCTGAATTCTTGG - Intronic
1003752431 6:9074587-9074609 ACTGTACTATTCTGAATCCTAGG + Intergenic
1003820902 6:9895872-9895894 TCAGTTCTATGCTGGATACTTGG + Intronic
1009950523 6:70390240-70390262 ACATTCCTATTATAGATATTTGG + Intergenic
1011207501 6:84915557-84915579 TTAGCCCTATTCTGGATCCTTGG - Intergenic
1011846879 6:91575952-91575974 ATAGTCATATTCTAGGTACTGGG - Intergenic
1012617134 6:101291122-101291144 ACAGTCACATTCTGGGTACTAGG - Intergenic
1014083117 6:117310995-117311017 ACAATTCTCTTCTGGATACAGGG - Intronic
1015132925 6:129834768-129834790 ACAGTTCTTTCCTGGATATTAGG - Intronic
1017240767 6:152165828-152165850 ACAGTTTTATTATGGCTACTGGG + Intronic
1017436145 6:154417601-154417623 ACAGTCACATTCTGGGTACTGGG - Intronic
1018290185 6:162284885-162284907 ACAGTCACATTTGGGATACTGGG - Intronic
1021253586 7:18361524-18361546 ACATTCTTATTCTGTATATTTGG + Intronic
1023623684 7:42096295-42096317 TGCGTCCTATTCTGGATTCTAGG - Intronic
1025532184 7:61901990-61902012 ACAGTCCTTTTGTAGATTCTGGG + Intergenic
1026503833 7:70965396-70965418 ACAGTCACATTCTGAATACTGGG - Intergenic
1027835190 7:83232773-83232795 ACAGTCACATTCTTGGTACTGGG - Intergenic
1028936254 7:96467214-96467236 ACAGTCTTACTCTGGATTCCAGG + Intergenic
1029301278 7:99583886-99583908 CCTGTCCTCTTCTGGATATTAGG + Intronic
1032727338 7:134603042-134603064 AAAGTCCTTGTCTGGATGCTTGG - Intergenic
1035207279 7:157301980-157302002 ACAGTCACATTCTGGGTACTGGG + Intergenic
1043838655 8:85075159-85075181 AAAGTCATTTTCTGGATACAAGG - Intergenic
1047460303 8:125057573-125057595 ACAGTACTATTCTGGAGAGTTGG - Exonic
1050032876 9:1404864-1404886 ACAGTCATATTCTGGAATCCTGG + Intergenic
1050815237 9:9802676-9802698 TAGGTCCTATTCTGGATACTGGG - Intronic
1050947746 9:11548276-11548298 AAAGTGCTATTCTGGCTTCTTGG + Intergenic
1051396045 9:16622012-16622034 ACAGTACTGGTCTGGACACTAGG + Intronic
1051754487 9:20382941-20382963 ACACTCCTATTCTGTAAACAGGG + Intronic
1056805802 9:89727816-89727838 ACAGTACTAGTCTAGATGCTGGG + Intergenic
1058465453 9:105222498-105222520 ACATTCCTATTGTGGATATAAGG - Intergenic
1060007337 9:120012240-120012262 ACAGTCTTATTTTGGTTATTAGG - Intergenic
1060487259 9:124055681-124055703 CAAGTTCTCTTCTGGATACTGGG + Intergenic
1062077959 9:134602369-134602391 ACAGTTTTATTCTGGGGACTTGG + Intergenic
1187340674 X:18418918-18418940 GCAGTTCTATCCTAGATACTGGG + Intergenic
1188504821 X:30871016-30871038 ACATACCCATGCTGGATACTAGG + Intronic
1189016413 X:37289728-37289750 ACAGGCCTATTTTGCACACTAGG + Intergenic
1190781071 X:53595410-53595432 ACAGTCTTATTCTGATTTCTGGG - Intronic