ID: 1078453032

View in Genome Browser
Species Human (GRCh38)
Location 11:11454408-11454430
Sequence CTCCATGCACAGTCCTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078453032_1078453040 14 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453040 11:11454445-11454467 ATATAGGGAGAAGGAAGATAAGG 0: 1
1: 0
2: 1
3: 47
4: 559
1078453032_1078453035 5 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453035 11:11454436-11454458 ACCCCCAAAATATAGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 166
1078453032_1078453041 17 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453041 11:11454448-11454470 TAGGGAGAAGGAAGATAAGGAGG 0: 1
1: 0
2: 9
3: 110
4: 1199
1078453032_1078453045 26 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453045 11:11454457-11454479 GGAAGATAAGGAGGGAGGCAGGG 0: 1
1: 1
2: 63
3: 1035
4: 9183
1078453032_1078453033 -2 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453033 11:11454429-11454451 AGTAATTACCCCCAAAATATAGG 0: 1
1: 0
2: 0
3: 17
4: 145
1078453032_1078453034 -1 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453034 11:11454430-11454452 GTAATTACCCCCAAAATATAGGG 0: 1
1: 0
2: 2
3: 19
4: 160
1078453032_1078453044 25 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453044 11:11454456-11454478 AGGAAGATAAGGAGGGAGGCAGG 0: 1
1: 1
2: 84
3: 1148
4: 10450
1078453032_1078453043 21 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453043 11:11454452-11454474 GAGAAGGAAGATAAGGAGGGAGG 0: 1
1: 2
2: 37
3: 719
4: 4794
1078453032_1078453042 18 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078453032 Original CRISPR CTCCATGCACAGTCCTATTC TGG (reversed) Intronic
902557463 1:17255379-17255401 TTCCATGCACAGGCCTGTCCAGG - Intronic
903555449 1:24189620-24189642 CTCCAAGCACAGTGGGATTCCGG - Intergenic
904774799 1:32900186-32900208 CTCCAGGCACAGCCCCATGCTGG - Intronic
907588896 1:55646886-55646908 CTGCATGCACACTCCAATCCAGG - Intergenic
914199955 1:145475825-145475847 CTCCCTGCTCAGTCGCATTCGGG + Intergenic
914479075 1:148048960-148048982 CTCCCTGCTCAGTCGCATTCGGG + Intergenic
919752295 1:201045343-201045365 CTCAATGCACTGTCTGATTCTGG + Intronic
923689232 1:236176554-236176576 CTCCCTGCACAGCCCTGTGCTGG - Intronic
1063017754 10:2095552-2095574 CTCCAAACACAGTCACATTCTGG - Intergenic
1064006857 10:11705686-11705708 CTCCAAGCACTTTCCTTTTCTGG + Intergenic
1065713551 10:28541566-28541588 TTCTATGAACAGTCCTTTTCAGG + Intronic
1066673993 10:37869093-37869115 CTCTATGGACTTTCCTATTCTGG + Intergenic
1067397022 10:45930542-45930564 CTCCATGCACAGTCTTATTTAGG - Intergenic
1067865338 10:49899643-49899665 CTCCATGCACAGTCTTATTTAGG - Intronic
1069743534 10:70700434-70700456 CTCCCTTCACAGTCCCATCCAGG - Intronic
1070271729 10:74963039-74963061 CTCCATCCACAGAGCTATTGTGG + Intronic
1074805480 10:117046786-117046808 CTCTATGGACTGTCCTATTTTGG - Intronic
1075350585 10:121721137-121721159 TTCAATGCACAGTCCTAGACTGG + Intergenic
1076862386 10:133144799-133144821 CTCCATCCACAGCTCCATTCAGG + Intergenic
1078280413 11:9895230-9895252 CTACATGCACAGTCAGCTTCAGG - Intronic
1078453032 11:11454408-11454430 CTCCATGCACAGTCCTATTCTGG - Intronic
1081073759 11:38642691-38642713 TTTCATGCCCAGTCCTATTGTGG + Intergenic
1082672478 11:56052515-56052537 CTTCATGAACAGTGCTATTTTGG - Intergenic
1083138717 11:60703961-60703983 CTCCAAACACAGTCAGATTCTGG + Intronic
1084843583 11:71879791-71879813 CTCTATGTATATTCCTATTCTGG + Intronic
1085804964 11:79627294-79627316 CACCATGCACAATCCCTTTCAGG + Intergenic
1089770105 11:120796659-120796681 CTCCATGTACAGTCCTGGACTGG - Intronic
1091360405 11:134974783-134974805 CTCCCTGCACCATCCTTTTCTGG - Intergenic
1093166495 12:15809825-15809847 CTCCTTGCTCATTTCTATTCTGG + Intronic
1094209920 12:27878187-27878209 CTCTATGCAAAGTCCAATTATGG - Intergenic
1100400175 12:94222518-94222540 CTCCATGCACACCCCTATCTTGG + Intronic
1100578945 12:95920640-95920662 CTCCATGAATATGCCTATTCTGG - Intronic
1102018820 12:109667000-109667022 CTTCAGGCACAGTGCGATTCAGG - Intergenic
1102755129 12:115333565-115333587 CTTCATGCACAGGCCCTTTCAGG + Intergenic
1104297404 12:127529272-127529294 CTCCAAGCACAGTCCCATTGAGG - Intergenic
1104353647 12:128066529-128066551 CTCCATGTACAGTCACATTGGGG - Intergenic
1105393149 13:20001101-20001123 CTCCATGCCCAGCCTCATTCAGG - Intronic
1108866855 13:54934344-54934366 CTCCATGTACAGGTCTATACAGG - Intergenic
1109729895 13:66398948-66398970 CCCCCTGCACAGTGCTATTCAGG - Intronic
1111149618 13:84232914-84232936 CTCCATGCCATGTCCTATTTTGG + Intergenic
1113341567 13:109431126-109431148 CTCCATGCTCAGTGCTGTACTGG - Intergenic
1113403282 13:110015232-110015254 CTCAATGCACAGTAGCATTCTGG + Intergenic
1113821997 13:113221304-113221326 CTCCATGAACAATCTAATTCTGG - Intronic
1115164098 14:30428811-30428833 CTCCATGCATTTGCCTATTCTGG - Intergenic
1119870117 14:78009637-78009659 CTCCATGGACTTGCCTATTCTGG + Intergenic
1122074820 14:99229306-99229328 CTCCATACACAGTCCTCATAAGG + Intronic
1122535251 14:102457454-102457476 CGCCATGCACAGTCATACACGGG - Intronic
1124069457 15:26378147-26378169 CTCTGTGCACAGTCATTTTCTGG + Intergenic
1128860155 15:71063485-71063507 CTCCATCCACAGCCCCCTTCAGG + Intergenic
1129429378 15:75487747-75487769 CTGAATTCACAGTCCTATCCAGG - Intronic
1133916892 16:10117090-10117112 CTCCATGCACAGGTGAATTCAGG + Intronic
1138990179 16:62381306-62381328 CTCAATGCACAACCCAATTCAGG - Intergenic
1140417329 16:74785119-74785141 CTTCATGGATTGTCCTATTCTGG + Intergenic
1141887141 16:86900088-86900110 CTCCATGAACTTACCTATTCTGG - Intergenic
1143503015 17:7349935-7349957 CTCCATGCAGAATTCTCTTCTGG + Exonic
1145065582 17:19759403-19759425 CTCCATGAACAGACCTGGTCAGG - Intergenic
1152402088 17:80072881-80072903 CTCCATGCAAAGATCTTTTCAGG - Intronic
1153719207 18:7884531-7884553 CTCTATGCACAGTCTTCCTCTGG - Intronic
1157113161 18:44840051-44840073 GACCATGCACAGGCCTCTTCTGG - Intronic
1157634076 18:49131610-49131632 CTCCAAACACAGTCTTATTGGGG + Intronic
1159882480 18:73871947-73871969 CACCATGCACAGTCCTAATCGGG + Intergenic
1161210057 19:3061640-3061662 CTCCCTGCAAAGTCCTCTTGGGG + Intronic
1164488780 19:28687111-28687133 CTCCATGCCCAAACATATTCTGG + Intergenic
1164961548 19:32435279-32435301 CTCCAAGAACAGTCATATTAGGG + Intronic
929002121 2:37357626-37357648 CTGCATGCACAATGCTATTTAGG + Intronic
931131633 2:59342839-59342861 CTCCAGGCACAGTCATTCTCTGG + Intergenic
931776542 2:65545837-65545859 CTCCATCCACAGTGCCCTTCTGG + Intergenic
932323844 2:70841622-70841644 CTCCAGACACAGTCATATTGAGG + Intergenic
932600941 2:73125087-73125109 CTCCAAGTACAGTCACATTCTGG + Intronic
933158804 2:79002084-79002106 CACCAAGCACAGTCCTACACAGG + Intergenic
936091789 2:109506315-109506337 CTCCATGGCCAGGCCTATGCTGG + Intergenic
941109761 2:161406533-161406555 CTTCATTCACAGTTCTAATCTGG - Intronic
942437172 2:175991935-175991957 CTCCATGCCCAGTGCCCTTCGGG + Intronic
943583165 2:189708113-189708135 CTGGATGCACAGTTCCATTCTGG - Intronic
945511296 2:210706309-210706331 CTGAATGAACAGGCCTATTCAGG - Intergenic
1169451216 20:5713239-5713261 CTCCAAACACAGTCATATTGTGG - Intergenic
1169742495 20:8910110-8910132 CTCCAAGCACAGTTCCATGCAGG + Intronic
1175192966 20:57223896-57223918 CTCCTTGCCCAGTCCTCTCCTGG - Intronic
1175799552 20:61793515-61793537 CTCCCTGGACAGTCATTTTCAGG + Intronic
1184414014 22:44341749-44341771 CTCCATGCTCATTGCTGTTCGGG + Intergenic
1185203846 22:49525510-49525532 CTCCTTGGACAGGCCTATCCGGG - Intronic
949702911 3:6779938-6779960 CTCCATGCAAATTTTTATTCTGG + Intronic
950833559 3:15898516-15898538 CTCCCTGGAGAGTCCTCTTCAGG + Intergenic
952743872 3:36760210-36760232 CTCCAAACACAGTGCTCTTCAGG + Intergenic
953376826 3:42435889-42435911 CTCCATACACAGACCTACTAAGG + Intergenic
955076900 3:55622263-55622285 CTCCATACAAAGTCCTATTCTGG + Intronic
959663836 3:108899709-108899731 CTCCAAGCACAGCCCTCCTCAGG - Intergenic
968247367 3:197165954-197165976 CAACATGCACTTTCCTATTCAGG - Intronic
969597085 4:8155623-8155645 CTCCATGCATAGTCACATCCTGG - Intronic
969784680 4:9445869-9445891 CTCTATGTATATTCCTATTCTGG + Intronic
970303945 4:14711328-14711350 CTCCATGCACAGTCATCTCTGGG + Intergenic
972467168 4:39368256-39368278 CACCATGCTCAGTCCTATTTTGG - Intergenic
973800076 4:54468998-54469020 CTCCAAACACAGTCCCATTGGGG + Intergenic
976148921 4:82073246-82073268 CTCCTTGCTCAGTCCTATATTGG + Intergenic
976983469 4:91261930-91261952 TACCATGCACAGTTATATTCAGG - Intronic
985110906 4:186545683-186545705 CTTCGTGAACAGTACTATTCAGG - Intronic
988833912 5:35013236-35013258 CTCCAAATACAGTCTTATTCAGG - Intronic
990237413 5:53783004-53783026 CTCTATGCACAGTCTTGTGCTGG + Intergenic
992954820 5:81896683-81896705 CTCCATGGATTTTCCTATTCTGG + Intergenic
994412802 5:99430589-99430611 CACCATGCACAGGCCTTTTGCGG + Intergenic
994481039 5:100335134-100335156 CACCATGCACAGGCCTTTTGCGG - Intergenic
995042932 5:107609643-107609665 CTCCATCCACAGTGTTATGCAGG + Intronic
996093184 5:119371216-119371238 CTCCACGCACAGTCCAATGCAGG - Intronic
996702465 5:126464208-126464230 CTGCCTGCACAGTCATATGCAGG + Intronic
997883712 5:137612702-137612724 TTCCCTGCCCAGCCCTATTCTGG + Intergenic
998689085 5:144567051-144567073 CTCCAGGAACATTCCTATACTGG + Intergenic
999242190 5:150134154-150134176 CTACATGCCAAGTACTATTCTGG + Intronic
1001804844 5:174574774-174574796 CACCATGCCCAGCCCTTTTCAGG - Intergenic
1005297371 6:24439322-24439344 CTCAATGGGCAGCCCTATTCAGG - Intronic
1005566107 6:27096537-27096559 TTCCATGCTCAGTCCCATTTGGG - Intergenic
1006418403 6:33918806-33918828 CTCCAGGCACAGTCCTAGGCTGG - Intergenic
1007236204 6:40392722-40392744 GTCCATGCACAGCCAGATTCTGG - Exonic
1011307537 6:85945109-85945131 CTGGATACCCAGTCCTATTCTGG + Intergenic
1013517681 6:110903351-110903373 CTCCTTGCTCAGTCCTCTCCAGG + Intergenic
1018043585 6:159946372-159946394 TTCCATGCACAGTGCTCTTCAGG + Intergenic
1018863488 6:167730338-167730360 CTGCATGCACAGTTCTCTCCTGG - Intergenic
1022319561 7:29276186-29276208 CTCCTTACACTGTCCTACTCAGG - Intronic
1023884969 7:44348126-44348148 CCCCATGCCCAGTGCTAGTCTGG - Intergenic
1033359626 7:140629398-140629420 CTCCATGCACTGGCCTCCTCAGG - Intronic
1034721719 7:153299669-153299691 CTCCTGGCACAGTCCTGGTCTGG + Intergenic
1034747800 7:153538602-153538624 CTCTATGCAAAGCACTATTCTGG + Intergenic
1035207275 7:157301972-157301994 CTCCAGGTACAGTCACATTCTGG + Intergenic
1036496656 8:9276282-9276304 ATCCCTGCTCACTCCTATTCTGG + Intergenic
1036834355 8:12048267-12048289 CTCTATGTATATTCCTATTCTGG - Intergenic
1038288718 8:26229209-26229231 CTCCATGCCAAGACCTGTTCTGG - Intergenic
1041441679 8:57903852-57903874 CACCATGCACACACCTATGCAGG - Intergenic
1041937258 8:63347830-63347852 CTCCAGGCACAGTCAAATTTGGG - Intergenic
1042778451 8:72462872-72462894 ATCCATGTGCTGTCCTATTCTGG + Intergenic
1045914877 8:107456334-107456356 CTCCAAGCTCAGTGGTATTCTGG + Intronic
1048896159 8:138994131-138994153 CTCCATGCACTGTCCTTTCATGG + Intergenic
1049156681 8:141071483-141071505 CTCCAAGCACAGTCATACTGGGG + Intergenic
1050032874 9:1404856-1404878 CTCCATATACAGTCATATTCTGG + Intergenic
1059095693 9:111411387-111411409 TTCCATGCCCACTCCAATTCCGG + Intronic
1060069862 9:120536643-120536665 CTCCATGTATAGTACAATTCAGG - Intronic
1062525134 9:136975171-136975193 CACCTTGCACAGTCCTAGCCGGG + Intergenic
1185952878 X:4455841-4455863 CTCCAAACACAGTCACATTCTGG + Intergenic
1188697358 X:33211638-33211660 GACCATGGACAGTCCTATTATGG - Intronic
1194213297 X:91096133-91096155 CTCAATGCCCAGTACTCTTCTGG + Intergenic
1198709353 X:139484448-139484470 ATCAATGCACAGTCCCTTTCTGG - Intergenic