ID: 1078453042

View in Genome Browser
Species Human (GRCh38)
Location 11:11454449-11454471
Sequence AGGGAGAAGGAAGATAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3265
Summary {0: 1, 1: 2, 2: 24, 3: 356, 4: 2882}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078453030_1078453042 26 Left 1078453030 11:11454400-11454422 CCAAGTATCCAGAATAGGACTGT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882
1078453029_1078453042 27 Left 1078453029 11:11454399-11454421 CCCAAGTATCCAGAATAGGACTG 0: 1
1: 0
2: 4
3: 8
4: 129
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882
1078453032_1078453042 18 Left 1078453032 11:11454408-11454430 CCAGAATAGGACTGTGCATGGAG 0: 1
1: 0
2: 4
3: 7
4: 127
Right 1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG 0: 1
1: 2
2: 24
3: 356
4: 2882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078453042 Original CRISPR AGGGAGAAGGAAGATAAGGA GGG Intronic
Too many off-targets to display for this crispr