ID: 1078454310

View in Genome Browser
Species Human (GRCh38)
Location 11:11463142-11463164
Sequence CAGTGATAACTGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 3, 3: 18, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078454310_1078454314 -4 Left 1078454310 11:11463142-11463164 CCTGCTTCCCTCAGTTATCACTG 0: 1
1: 2
2: 3
3: 18
4: 229
Right 1078454314 11:11463161-11463183 ACTGGCTGTATCCTCACACATGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078454310 Original CRISPR CAGTGATAACTGAGGGAAGC AGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900270576 1:1785216-1785238 CAGGGACAGCTTAGGGAAGCGGG + Intergenic
900569633 1:3351917-3351939 CACTGATGCCTGAGGGTAGCTGG + Intronic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
903974673 1:27141699-27141721 CAGTGCTCAGTCAGGGAAGCGGG + Intronic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
905502623 1:38451715-38451737 CAGTGATGACTCAGGCAGGCTGG - Intergenic
907532016 1:55108659-55108681 GAGTGATAAATGAGGGACCCAGG - Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
909729050 1:78871762-78871784 GAGTGATAACTTAGGGAATCCGG - Intergenic
910262997 1:85309558-85309580 GAGTGATAACTAAGGGTAGAGGG - Intergenic
912544694 1:110442197-110442219 CAGTGATTACTTAAGGAAACAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
916051660 1:161040744-161040766 CAGTGATGTCTGAGGGGAGGAGG - Intronic
918825657 1:189320441-189320463 CAGAGATAACTGAGGTGAGGAGG + Intergenic
919686319 1:200486875-200486897 AAGTGAAAACTGAGGGCACCTGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
923570819 1:235112710-235112732 CACTGATAATTGAGTGAAGGAGG + Intronic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924361382 1:243245053-243245075 TTGTTATAAGTGAGGGAAGCAGG + Intronic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1072275171 10:93815840-93815862 CAGAGATAACTGAGAGGAGGTGG + Intergenic
1072618690 10:97066148-97066170 CTGTGATAAGTCAGGGAAGCAGG + Intronic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073424586 10:103448778-103448800 AAGTGTTAACTTAGAGAAGCAGG - Intronic
1073435968 10:103516278-103516300 CACTGATAACTGAATGATGCAGG + Intronic
1073687384 10:105770110-105770132 CAGTAATATTTGAGGGAATCTGG + Intergenic
1073889557 10:108083630-108083652 TAATAATAACTGAGGAAAGCTGG - Intergenic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1079640640 11:22800611-22800633 CCCTGAAAACTGAGGGCAGCAGG - Intronic
1079921308 11:26437067-26437089 CAGTGATACCTGTGGCAGGCTGG + Intronic
1081828649 11:46085399-46085421 CAGTGATGACTGAGGGAGATAGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083627687 11:64079894-64079916 CAGTCGTAAATGAGGGAGGCAGG + Intronic
1084082870 11:66840433-66840455 CAGTGATAACTGATGCAAGCAGG - Intronic
1084424304 11:69076387-69076409 CATTGAGGACTGTGGGAAGCTGG + Intronic
1084804587 11:71570061-71570083 CAGTCACAACTGAGAGAAGGGGG - Intergenic
1084805868 11:71578567-71578589 CAGTCACAACTGAGAGAAGGGGG + Intergenic
1085317639 11:75555137-75555159 CAGTGAGCTCTGGGGGAAGCTGG - Intergenic
1085729495 11:78984086-78984108 CTCTGAAAAATGAGGGAAGCAGG + Intronic
1086606504 11:88702404-88702426 CTGTGAGAGCTGAGCGAAGCAGG - Intronic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1088287113 11:108200653-108200675 CACTGATAACTCAAGGATGCAGG + Intronic
1091326009 11:134688451-134688473 AAGTCATATCTGTGGGAAGCAGG - Intergenic
1091783865 12:3230719-3230741 AGGAGATAACTGAGGGCAGCTGG - Intronic
1093642947 12:21549197-21549219 CAGTGATAACTGTAGTAAGTGGG - Intronic
1094193675 12:27723230-27723252 CTCTGATACCTGGGGGAAGCTGG + Intronic
1094409387 12:30152720-30152742 CAGTGCTAACTCAGTGAAGCAGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1097139217 12:56885889-56885911 CAGTAATAATTTAGGGTAGCTGG + Intergenic
1097945713 12:65365862-65365884 CAGTGGTAACTGGGCCAAGCTGG + Intronic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1100234233 12:92642607-92642629 GAGTGATAACTAAAGGATGCAGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101516614 12:105441870-105441892 CAGAGAAAACTGGGGTAAGCAGG - Intergenic
1101992415 12:109497910-109497932 CAGTGACCCCTGAGGTAAGCAGG + Exonic
1102558540 12:113745843-113745865 CATTTATAACTGGGGGAAGGAGG + Intergenic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104591104 12:130085295-130085317 CAGGGAGCAGTGAGGGAAGCAGG - Intergenic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1109305821 13:60640480-60640502 CAGAGACAACTGAATGAAGCTGG - Intergenic
1113594409 13:111521053-111521075 CAGTCACACCTGGGGGAAGCTGG + Intergenic
1114846334 14:26327148-26327170 GAGTGATGAGTAAGGGAAGCTGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1121948110 14:98142525-98142547 CAGTGATCACTGAGTCTAGCTGG + Intergenic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1129494088 15:75960204-75960226 GAGTGATTAATGAGGGAAGTAGG + Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130303473 15:82698004-82698026 CATTCATATCTCAGGGAAGCTGG - Intronic
1130970362 15:88727475-88727497 GAGTGATGATTAAGGGAAGCTGG + Intergenic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1136146279 16:28318307-28318329 TTGTGCTAACTGAGGGCAGCAGG + Intronic
1138837873 16:60460040-60460062 CAGAGAGAACTGAGGGTAGTTGG - Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1141176150 16:81720580-81720602 CCGTGAGCACTGAGGGCAGCTGG - Intergenic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143543115 17:7581231-7581253 CAGTGATAAAAGGGGGAAACTGG - Intronic
1144010720 17:11146218-11146240 AAGTGATTACTGTGGAAAGCTGG - Intergenic
1144074221 17:11702375-11702397 TACTGTTAACTGAGGGAAGGAGG - Intronic
1148020098 17:44547882-44547904 TGGTGATAACTGGGGGAAGGGGG - Intergenic
1149324078 17:55511974-55511996 CAGTGATAAGACAGAGAAGCAGG + Intergenic
1151375884 17:73688818-73688840 CAGTGATCACTCAGGGTGGCTGG + Intergenic
1151477832 17:74353856-74353878 CAGTGATTACTGAGCGGAGGCGG - Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1158414958 18:57242133-57242155 CAGTGGTAACTCAGAGAGGCAGG + Intergenic
1158904856 18:62001880-62001902 CAGTGATGACTTAGGGTATCTGG - Intergenic
1158908559 18:62037567-62037589 CTGTGAGCACTGAGGGCAGCGGG + Intergenic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1163030272 19:14539609-14539631 TAGTAACAACTGAGGAAAGCAGG - Intronic
1165136187 19:33671013-33671035 CAGTGATGACTGGGAGAAGGAGG - Intronic
1166587209 19:43960211-43960233 GAGTGATAACTTAGGGTACCTGG + Exonic
1166990140 19:46687708-46687730 CAGTGATAGCTCAGGTGAGCAGG - Intronic
1168666733 19:58210060-58210082 CAGTGCTCCCTGAGGTAAGCGGG + Exonic
1168673042 19:58255897-58255919 CCTTGGTAACTGAGGGCAGCTGG - Intronic
925275609 2:2645818-2645840 CAGAGCCAACTGAGGCAAGCAGG - Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
926307382 2:11648277-11648299 CGGTGATATCTGAGTGAAGGAGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929777731 2:44939128-44939150 CAGGGAGAACTGAGGCAAGTGGG - Intergenic
930116141 2:47719999-47720021 TAGTGACTACTGAGGGATGCCGG - Intronic
930328987 2:49958529-49958551 CAATGATAACGAAGGGAAGAGGG - Intronic
931326455 2:61230428-61230450 CAGGGAGAACTGTGTGAAGCCGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931977663 2:67660876-67660898 CAGTGATTCCTGAGGGACTCAGG - Intergenic
937766683 2:125669415-125669437 TTGTAATAACTGAGGGAATCAGG + Intergenic
939697933 2:145350994-145351016 CAATGAAAAATGAGGGATGCAGG - Intergenic
941073851 2:160985441-160985463 CATGAATAACTGAGGCAAGCTGG + Intergenic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
943374331 2:187055860-187055882 CATGGAAAACTGAGGGAAGTGGG - Intergenic
943663691 2:190586393-190586415 CAGTGATCACTGAGAGAACAAGG - Intergenic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
948288487 2:236806307-236806329 CAGTAATAACTGAGGGACCGGGG + Intergenic
948885011 2:240878027-240878049 CAGTGGTGACTGTGGGAAGCCGG - Exonic
1169413315 20:5393317-5393339 AATTGTTAACTGAGGAAAGCAGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1172431002 20:34891743-34891765 CAGGGAGAAATGAGAGAAGCAGG - Intronic
1174382077 20:50162397-50162419 CAAAGATAAGGGAGGGAAGCTGG + Intergenic
1175846336 20:62060906-62060928 CAGTGAAAAATGAGGGGAACTGG + Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
949592447 3:5508640-5508662 CAGTGATAAGTGAGGGGTGATGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953233536 3:41085682-41085704 CTGTGACATCTGAGGGCAGCAGG + Intergenic
953518276 3:43618175-43618197 CACAGATAACTTAGGGAAGCTGG + Intronic
953658770 3:44874940-44874962 CAGTAATAATTTAGGGAATCTGG - Intronic
953847636 3:46440707-46440729 CAGTGATTACTGAAGGAGGGAGG + Intronic
953885323 3:46711790-46711812 CTGTGATAACTGTGGGAGTCGGG - Intergenic
954403073 3:50329440-50329462 CAGTTAGAACTTAGGGAAACTGG - Intergenic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
959878355 3:111413335-111413357 CAATGATCACTGAGAGAAGAAGG - Intronic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961931966 3:130544161-130544183 TGGTGATTACTGGGGGAAGCAGG - Intergenic
961980599 3:131074057-131074079 CAGTTATCACTGAGGGCAGTTGG - Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962661840 3:137609532-137609554 CAGTGTTAACTTTGGGAAGTAGG - Intergenic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
965556267 3:170021449-170021471 CATTGATAATTGAATGAAGCTGG - Intergenic
965788416 3:172361431-172361453 GAGTGATAACTTAGGGTATCTGG - Intronic
966581639 3:181573606-181573628 CACGGATAAATGAGAGAAGCTGG + Intergenic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
973695148 4:53483552-53483574 AAGTGATAAATGAGGTCAGCTGG - Intronic
975506593 4:75144962-75144984 GAGTGATAACTTAGGGTACCTGG - Intergenic
975830813 4:78366673-78366695 CAGAAACCACTGAGGGAAGCTGG - Intronic
980256289 4:130383992-130384014 CAGTGATTACTGGGGAAATCAGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
981582569 4:146264830-146264852 CAGTGAAAACTGAGGGGAAAAGG - Intronic
986449658 5:7851346-7851368 GAGTGATCAGTGAGTGAAGCAGG - Exonic
986694349 5:10338845-10338867 CAGTGATGAGTGAAGTAAGCTGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
995376664 5:111481787-111481809 AATTCATAAATGAGGGAAGCAGG - Intronic
995852828 5:116563902-116563924 CAGAGATATCTGAGGGGAGGTGG + Intronic
997579444 5:135008082-135008104 CCATGATAACTGGGGGAACCTGG + Exonic
997724101 5:136105887-136105909 CAGTGAAGACAGAGGTAAGCAGG - Intergenic
998495549 5:142585535-142585557 TAGTGATAGAAGAGGGAAGCTGG - Intergenic
998562067 5:143180993-143181015 CAGTGATGAGTAAAGGAAGCTGG - Intronic
999476065 5:151899864-151899886 CAGTCATAACTGTGGGAGGTAGG - Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1004201223 6:13549750-13549772 CACTGATAGCTGAGTGGAGCAGG + Intergenic
1004884221 6:20036421-20036443 CAGTGATATCTGTGAGAAACAGG - Intergenic
1006900833 6:37499872-37499894 CAGTGATGACTGGGGGATCCCGG - Exonic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1009036934 6:58128988-58129010 CTTTGATAACTGAGCCAAGCAGG + Intergenic
1009212740 6:60882593-60882615 CTTTGATAACTGAGCCAAGCAGG + Intergenic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010201523 6:73286423-73286445 CAGGTATAAATGAGGGAATCAGG - Intronic
1011738634 6:90337270-90337292 CACTGATAACTGAGGGCAGGAGG - Intergenic
1014633648 6:123817729-123817751 CAGTGGTAAATGAGGAGAGCAGG + Intronic
1016683009 6:146852285-146852307 CAATGATAACTCAGTAAAGCTGG - Intergenic
1016801557 6:148174189-148174211 CTTTGGTAACTGATGGAAGCAGG - Intergenic
1017979779 6:159390565-159390587 GATTGAGAACTGAGGGGAGCAGG + Intergenic
1018564329 6:165135977-165135999 CAGTGATAATTTAGGGTATCTGG + Intergenic
1019321782 7:419313-419335 CAGGGGTGACTGAGGGGAGCTGG - Intergenic
1020004313 7:4774251-4774273 CAGTGATGTCTGAGGGCACCTGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1023348258 7:39293567-39293589 ACGTGATAGCCGAGGGAAGCAGG + Intronic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1025943231 7:66088520-66088542 GAGTGATAACTCAGTAAAGCTGG + Intronic
1026148907 7:67771711-67771733 GAGTGAGAACTGAGGGATCCAGG - Intergenic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1031583960 7:123511065-123511087 CAGTTATACCTGACTGAAGCAGG - Intronic
1031749742 7:125556937-125556959 GAGTGATAATTTAGGGTAGCTGG - Intergenic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1041835017 8:62201926-62201948 CATTGATGACTGAGAAAAGCAGG - Intergenic
1042016139 8:64314662-64314684 CTGTGATAACTGAGCTAAGCTGG - Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045880263 8:107030089-107030111 GAGTGATAACTTAGGGTATCTGG + Intergenic
1047029728 8:120863147-120863169 TAATGATAACTGAGTGAAGGGGG + Intergenic
1049688108 8:143947091-143947113 CAGTGATCCCTGTGGAAAGCTGG + Intronic
1051187429 9:14474864-14474886 CACTGATATCTGAGGGCAGGAGG + Intergenic
1051699853 9:19810164-19810186 CAGGGATTAGTGAGGGTAGCTGG + Intergenic
1054990112 9:71315485-71315507 CAGTGACAACTGAGTAAAGCAGG - Intronic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056312973 9:85359690-85359712 CAGTGATGACTTAGGGTATCTGG - Intergenic
1056363139 9:85878939-85878961 CACAGATCACTGAGGGAGGCAGG + Intergenic
1058736996 9:107902824-107902846 CAGTGGTAACTTAGGTAAGCTGG - Intergenic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1061520181 9:131113143-131113165 CAGTGAGAAATGAGGGAGGGAGG + Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1185865564 X:3620767-3620789 CAGTGATAACTGAAGGGTGCAGG + Intronic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1189225169 X:39406747-39406769 GAGGGATACATGAGGGAAGCAGG - Intergenic
1190588148 X:51967892-51967914 CAGTGATACCTGAAGCCAGCAGG + Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1190711254 X:53072289-53072311 CAGAGATAAGAGAGGGTAGCTGG - Intronic
1193565580 X:83072411-83072433 CATTAATAACTGAAGGAAACAGG + Intergenic
1193680398 X:84511948-84511970 CAGTGATCAGTTATGGAAGCAGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197331897 X:125163004-125163026 CATTGGTAACTCTGGGAAGCTGG - Intergenic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1200121294 X:153792137-153792159 CAGTGATAACCTAGGGAAGGGGG - Intronic
1200798137 Y:7360708-7360730 CAGTGATAGCTGAAGGGTGCAGG - Intergenic