ID: 1078457711

View in Genome Browser
Species Human (GRCh38)
Location 11:11488310-11488332
Sequence GGACCCCGAGTCAAGGAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078457711_1078457715 9 Left 1078457711 11:11488310-11488332 CCGCATTCCTTGACTCGGGGTCC 0: 1
1: 0
2: 8
3: 60
4: 336
Right 1078457715 11:11488342-11488364 GTCTTCACAGTCAGCCCAGGTGG 0: 1
1: 0
2: 0
3: 25
4: 178
1078457711_1078457714 6 Left 1078457711 11:11488310-11488332 CCGCATTCCTTGACTCGGGGTCC 0: 1
1: 0
2: 8
3: 60
4: 336
Right 1078457714 11:11488339-11488361 TCTGTCTTCACAGTCAGCCCAGG 0: 1
1: 1
2: 4
3: 46
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078457711 Original CRISPR GGACCCCGAGTCAAGGAATG CGG (reversed) Intronic