ID: 1078459115

View in Genome Browser
Species Human (GRCh38)
Location 11:11499829-11499851
Sequence CTCACAGGTGATGGGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078459103_1078459115 24 Left 1078459103 11:11499782-11499804 CCAATTTAGTACTGACACAGCAC 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG 0: 1
1: 0
2: 1
3: 10
4: 150
1078459102_1078459115 25 Left 1078459102 11:11499781-11499803 CCCAATTTAGTACTGACACAGCA 0: 1
1: 0
2: 2
3: 8
4: 115
Right 1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG 0: 1
1: 0
2: 1
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078459115 Original CRISPR CTCACAGGTGATGGGTAATG TGG Intronic
901000607 1:6147050-6147072 CACACAGGAGATGGGCAGTGGGG + Intronic
903621585 1:24702100-24702122 CTCATAGGTGATGGGATATGTGG - Intergenic
904269111 1:29337639-29337661 CTTCCAGGTGATGAGTGATGTGG - Intergenic
906518311 1:46452556-46452578 CCCACAGGTGCTGGGGTATGGGG - Intergenic
912167874 1:107061425-107061447 CTCACAGGTGCTTGGTGCTGAGG + Intergenic
913968862 1:143398750-143398772 CTCACAGTTAATTGGTAAAGAGG - Intergenic
914063241 1:144224349-144224371 CTCACAGTTAATTGGTAAAGAGG - Intergenic
914115909 1:144742005-144742027 CTCACAGTTAATTGGTAAAGAGG + Intergenic
916089422 1:161295796-161295818 CTTCCAGGTGATGAGAAATGTGG - Intergenic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
918381991 1:183965349-183965371 CTCACACTTGATGGATAATTTGG - Intronic
918727044 1:187939230-187939252 CACACAAGTGGTGGGAAATGGGG + Intergenic
919832472 1:201551887-201551909 CTCACAGGAGATGTGTAAATTGG - Intergenic
922364012 1:224846939-224846961 CTCAAAGGTGGTGGGTAAGCAGG - Intergenic
1064168162 10:13004312-13004334 CTTCCAGGTGATGGGACATGTGG + Intronic
1065150990 10:22823212-22823234 CTCACAGCACATGGGCAATGTGG - Intergenic
1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG + Intergenic
1068343305 10:55737410-55737432 CTCAAAGATGATCTGTAATGTGG + Intergenic
1069769887 10:70891480-70891502 CTGACAGTTGAAGGGTGATGAGG + Intergenic
1073162728 10:101414122-101414144 CTGAGAGGTGATGGGTAATGGGG - Intronic
1073408231 10:103317495-103317517 CACAGAGGTGCTGGGTACTGTGG + Intronic
1075793520 10:125102917-125102939 CTCGTAGGTGAGGGATAATGTGG - Intronic
1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG + Intergenic
1076468696 10:130703726-130703748 CTCACAGCTGATGGCTCACGTGG - Intergenic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1080112189 11:28580935-28580957 CTGATAGGTGAGGGGTAAAGAGG + Intergenic
1082617676 11:55381034-55381056 TTTCCAGGTGATGGGAAATGTGG + Intergenic
1082619790 11:55406126-55406148 CTTCTAGGTGATGGGAAATGTGG + Intergenic
1083967157 11:66049936-66049958 CTCCCAGGTGATGGGAGCTGAGG - Intergenic
1085139021 11:74123067-74123089 CTCCCAGGAGATGGGGAATCTGG + Exonic
1091684582 12:2552642-2552664 GACACAGGTGAGAGGTAATGTGG + Intronic
1091921309 12:4307205-4307227 CTCACAGCCGATGTGTTATGTGG + Intergenic
1092025366 12:5235029-5235051 CTCACAGCGGGTGGGTGATGGGG - Intergenic
1092084901 12:5748763-5748785 ATCACAGGAGATGGGTTATTAGG - Intronic
1095045629 12:37500935-37500957 CTTACTGGTGATGGGACATGTGG - Intergenic
1099969817 12:89489338-89489360 CTCACAGCTGATAAGTAGTGGGG + Intronic
1101140405 12:101789897-101789919 TTCACATCAGATGGGTAATGTGG - Intronic
1101196803 12:102391901-102391923 CTCATAGGTGCTGAGAAATGTGG + Intergenic
1103128386 12:118445079-118445101 TTCAGAGGTGATAGGTCATGAGG + Intergenic
1103822417 12:123709679-123709701 CTTACAGGTGATGTGCCATGTGG - Intergenic
1103871999 12:124098930-124098952 CTCACAGGAGAAGGAAAATGAGG - Intronic
1109818666 13:67622867-67622889 TTAAGAGGTGATTGGTAATGAGG + Intergenic
1111166621 13:84465644-84465666 TTCACAAATGATAGGTAATGAGG + Intergenic
1111975208 13:94959771-94959793 CTCAGACTTGAGGGGTAATGGGG - Intergenic
1112370468 13:98788767-98788789 CTCACTGGGGAGGGGGAATGGGG - Intergenic
1112824523 13:103376776-103376798 CTCAAAGGAGGTGGGAAATGTGG - Intergenic
1112955813 13:105056763-105056785 CCCATAGCTGATGGGTCATGAGG - Intergenic
1113876754 13:113599544-113599566 CTCAAAGGTGTTGGGTGTTGGGG + Intronic
1119089202 14:71764852-71764874 CTCACAGGTGCTGGGGGCTGGGG + Intergenic
1119203837 14:72779307-72779329 GTCCCAGGTGCTGGGTGATGAGG - Intronic
1121792621 14:96710576-96710598 CTCACAGATGGTGGGTGATTAGG + Intergenic
1122004760 14:98693000-98693022 GTCACAGGAGATGAGGAATGTGG - Intergenic
1124205032 15:27710684-27710706 TTCACAGGTTCTGGGTATTGGGG - Intergenic
1124645875 15:31437220-31437242 CTCACAGGTGACTGGGAATGTGG + Intergenic
1126695132 15:51319545-51319567 GTGACAGGTGATGGGTTATGAGG - Intronic
1128182128 15:65613315-65613337 CTCACAGGGGCTAGGTACTGGGG + Intronic
1128287950 15:66454074-66454096 CTCACAGAGGATGGGGAAAGAGG - Intronic
1129267663 15:74402715-74402737 CTCACATCTGCTGGGAAATGAGG + Intergenic
1133785762 16:8971915-8971937 TTCACAGGAGGTGGGCAATGGGG + Intergenic
1135395750 16:22130443-22130465 CTCAGAAGAGATGGGTGATGAGG + Intronic
1136360092 16:29773697-29773719 TTCACAGGGGAGGGGAAATGGGG - Intergenic
1140029937 16:71327567-71327589 CTCACAGGTCCTGGGCGATGAGG + Intergenic
1140755419 16:78062072-78062094 CTCTCAGATGATGGGTAACATGG - Intronic
1141870808 16:86784275-86784297 CTCAGAGGTGCTGGGGTATGGGG + Intergenic
1145934440 17:28706626-28706648 TTCCCAGGTGAGGGGTGATGAGG + Intronic
1146127748 17:30242025-30242047 AGCACTGGTGATGTGTAATGTGG - Intergenic
1150995032 17:70307390-70307412 GTCAGAGGTGATGGTTTATGAGG + Intergenic
1151365117 17:73612014-73612036 CTGGCGGCTGATGGGTAATGTGG - Intronic
1155289839 18:24329977-24329999 CTCAAAGCTGATTGGTTATGTGG + Intronic
1155398580 18:25414129-25414151 GTCACAGCTGATGGAAAATGTGG - Intergenic
1159975786 18:74710617-74710639 CTCAGAGAAGATGGGTGATGTGG - Intronic
1160095352 18:75866729-75866751 CTCACAGATGACAGGCAATGGGG - Intergenic
1162060363 19:8091056-8091078 CTCACAGGTCAGGGGCAATAAGG - Intronic
1165585794 19:36915117-36915139 CTCATGTGTGGTGGGTAATGGGG - Exonic
1168415386 19:56164450-56164472 CTCACAGGTGATTGCTAACTGGG + Intergenic
926849314 2:17177569-17177591 CTCTCTGGTGCTGGGTACTGGGG + Intergenic
929266705 2:39926457-39926479 TTCAAAGGTGATGGGGAATTTGG - Intergenic
934173563 2:89559673-89559695 CTCACAGTTAATTGGTAAAGAGG - Intergenic
934283877 2:91634026-91634048 CTCACAGTTAATTGGTAAAGAGG - Intergenic
934524609 2:95043845-95043867 CTCCCAGGGGATGGGCAGTGGGG - Intronic
934937606 2:98476703-98476725 TTCTCAGGTGATGGTGAATGAGG - Intronic
937902897 2:127036086-127036108 CTCACAGGTGGTAGGAAAGGTGG + Intergenic
938554669 2:132414229-132414251 CTCACAGGAGTAGCGTAATGGGG - Intergenic
938773785 2:134523424-134523446 CTCAGAGATGATTGGAAATGAGG + Intronic
938811745 2:134860314-134860336 GTCACAGGTGAAGCATAATGTGG - Intronic
939681590 2:145141650-145141672 GTCTCAGGTGATGGCTATTGTGG + Intergenic
943394693 2:187319577-187319599 GTCACAGGTGTTAGGTTATGAGG - Intergenic
943763026 2:191630482-191630504 GTCACAGGAGATGGGGGATGAGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947215230 2:227744138-227744160 CTCACAGGTGTGGGGCTATGAGG - Intergenic
947622259 2:231598176-231598198 CTGACAGGTGGTGGGACATGAGG + Intergenic
947912213 2:233808845-233808867 CCCACAGGTGATGGGTGGTCTGG + Intronic
948359717 2:237411805-237411827 CCCACAGGTGAGGGGACATGTGG - Intronic
948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG + Intronic
948993260 2:241565066-241565088 CACACAGCTGACGGGGAATGTGG + Intronic
1170444810 20:16415510-16415532 CACTCAGTAGATGGGTAATGTGG - Intronic
1170561551 20:17562997-17563019 CTCACAAGTGCTGTGTCATGCGG + Intronic
1171843222 20:30240908-30240930 CTTACTGGTGATGGGACATGTGG - Intergenic
1173294217 20:41741281-41741303 CTCTCTGGTGATTAGTAATGTGG + Intergenic
1180610287 22:17092062-17092084 CCCAGATGTGATGGGTAAAGGGG - Intronic
1182032365 22:27169373-27169395 CCCACAGCTGATGGGGGATGGGG - Intergenic
1182776554 22:32835536-32835558 GTGGCAGTTGATGGGTAATGGGG + Intronic
949234085 3:1787382-1787404 GTCACAGGTGATAGGGACTGAGG + Intergenic
950102723 3:10367943-10367965 CACACAGGTGATGAGTGTTGGGG + Intronic
950313584 3:11980247-11980269 CTCCCAGGTGATGACCAATGCGG - Intergenic
954877486 3:53811652-53811674 CTCACAGAGGATGGGTGAGGAGG + Exonic
955564291 3:60227115-60227137 CTAACAGGTGTTAGGTTATGTGG - Intronic
957309968 3:78507061-78507083 GTCACAGGAGATGGGAAGTGAGG - Intergenic
963766370 3:149340220-149340242 CCCACAGGTGACGGGAAGTGGGG + Intergenic
964536976 3:157733160-157733182 GTCACAGTTGCTGGGTAATATGG - Intergenic
965301036 3:167004953-167004975 CTGGAAGGTGCTGGGTAATGGGG + Intergenic
969517841 4:7658386-7658408 TTCACAGATGATGGATGATGAGG + Intronic
969827420 4:9768489-9768511 CTCACAGTTAATTGGTAAAGAGG - Intergenic
970292032 4:14583487-14583509 CTCATAGGTTATGAGTCATGAGG + Intergenic
972080093 4:35139663-35139685 TTCACAGGTGATGGGGATTAAGG + Intergenic
972161806 4:36236274-36236296 TCCACTGGTAATGGGTAATGGGG - Intronic
974444856 4:61966534-61966556 CTTAAAGGTGTTGGGTGATGTGG - Intronic
976622838 4:87146486-87146508 CTCACAGGTGATACCTACTGAGG - Intergenic
977477464 4:97530785-97530807 CTCACCGCTGCTGGGAAATGGGG - Intronic
979003935 4:115264460-115264482 CTCACAGAGGAAGGGCAATGTGG + Intergenic
979881096 4:125961502-125961524 CTGACAATTGATGGGTGATGAGG - Intergenic
981615862 4:146643093-146643115 CTTAAAGGTCATGGGAAATGAGG - Intergenic
981842192 4:149125593-149125615 CCCACAGGGAATGGGTAATGGGG - Intergenic
982083060 4:151808788-151808810 GTGACAGGTGATGGCTCATGAGG + Intergenic
983106403 4:163691827-163691849 CACACAGCAGCTGGGTAATGTGG - Intronic
983206315 4:164913923-164913945 CTCACTGTTGTTGGGTTATGAGG + Intergenic
984630196 4:182052712-182052734 ATCACAGCAGATGGGAAATGGGG + Intergenic
985134107 4:186767959-186767981 CTGGCAGCTGATGGGAAATGTGG - Intergenic
985285460 4:188332318-188332340 CTCACAGGGGAAAGGTCATGTGG + Intergenic
987876133 5:23683850-23683872 GTCACAGTTGATGTGTAAAGTGG - Intergenic
1002293029 5:178212493-178212515 ATCCTAGGTGATGGGGAATGTGG + Intronic
1003805217 6:9720740-9720762 CTCATAGCTGATGACTAATGTGG - Intronic
1003953059 6:11136191-11136213 CTCAAAGGTAATGCGTATTGAGG + Exonic
1005152730 6:22771459-22771481 CACACAGGTGATGTGGAATTTGG + Intergenic
1006809100 6:36808432-36808454 CTCCCAGCTGGTGGGTGATGAGG - Intronic
1013267291 6:108512373-108512395 CACACATGTGATGGGTAATCTGG + Intronic
1013604869 6:111738463-111738485 CTCACTGGAGAGGGGTAATGGGG + Intronic
1015812153 6:137171587-137171609 TTCACAGGTGCTGGGTCATGGGG - Intronic
1016153856 6:140780103-140780125 CTGACAGGGGATGGGGAATGGGG - Intergenic
1017314412 6:153013853-153013875 CTCACAGATGTTGGTTCATGAGG + Intronic
1019605550 7:1908317-1908339 ATCAGAGCTGATGGGTAATTTGG + Intronic
1021954628 7:25812206-25812228 CTCACAGCTTAAGGGGAATGTGG - Intergenic
1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG + Intronic
1025291625 7:57730778-57730800 CTTACTGGTGATGGGACATGTGG - Intergenic
1026505847 7:70982407-70982429 TTCACAGGGGATGGGCAAAGTGG - Intergenic
1031351143 7:120732401-120732423 TTCACAAGTGAAGGTTAATGGGG + Intronic
1033011406 7:137626425-137626447 CTCTCAGGTGTTGGGGACTGTGG - Intronic
1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG + Intronic
1035479995 7:159174570-159174592 CTCACAGGGGTTGGTTCATGAGG - Intergenic
1041893732 8:62900857-62900879 CTCACAGTTGATGGTTATGGTGG - Intronic
1044303263 8:90609432-90609454 CTCACTGGTGATGGGTCTGGAGG + Intergenic
1046690853 8:117282812-117282834 CTCACAATTGAAGGGTAAGGAGG - Intergenic
1047706451 8:127504481-127504503 CCCACAGCTGACTGGTAATGAGG + Intergenic
1049677242 8:143896120-143896142 CTCACAGTTGATGGGCATTTGGG + Intergenic
1049821767 8:144638890-144638912 CTCACAGGGAATGGGTGAAGTGG - Intergenic
1054164874 9:61714922-61714944 CTTACTGGTGATGGGACATGTGG + Intergenic
1058150530 9:101459024-101459046 CTCACATGTGAAAGGGAATGAGG + Intergenic
1060839270 9:126781394-126781416 CTCCCAGGTGATGGGGAAGGGGG + Intergenic
1061269495 9:129529758-129529780 CTCACAACTGATTGATAATGTGG - Intergenic
1187069456 X:15873973-15873995 CCCACAGGTGATGGAGTATGTGG - Intergenic
1192276935 X:69641907-69641929 CTCACAGTTGATGTGAAAAGTGG + Intronic
1193978013 X:88147554-88147576 TCCACAGGTGAAGGGGAATGGGG - Intergenic