ID: 1078459194

View in Genome Browser
Species Human (GRCh38)
Location 11:11500475-11500497
Sequence ACCAAAAACATCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 4, 2: 32, 3: 91, 4: 354}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078459194_1078459196 -7 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459196 11:11500491-11500513 TTTTGGTTGTCACATCGTGGTGG 0: 1
1: 1
2: 41
3: 205
4: 505
1078459194_1078459198 -3 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459198 11:11500495-11500517 GGTTGTCACATCGTGGTGGGTGG 0: 1
1: 0
2: 2
3: 24
4: 162
1078459194_1078459195 -10 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459195 11:11500488-11500510 TGTTTTTGGTTGTCACATCGTGG 0: 1
1: 1
2: 17
3: 120
4: 635
1078459194_1078459201 15 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459201 11:11500513-11500535 GGTGGATGGAGATGCGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 168
1078459194_1078459199 1 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459199 11:11500499-11500521 GTCACATCGTGGTGGGTGGATGG 0: 1
1: 0
2: 2
3: 9
4: 226
1078459194_1078459200 14 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459200 11:11500512-11500534 GGGTGGATGGAGATGCGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 197
1078459194_1078459197 -6 Left 1078459194 11:11500475-11500497 CCATGTCTGGAGATGTTTTTGGT 0: 1
1: 4
2: 32
3: 91
4: 354
Right 1078459197 11:11500492-11500514 TTTGGTTGTCACATCGTGGTGGG 0: 1
1: 0
2: 6
3: 78
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078459194 Original CRISPR ACCAAAAACATCTCCAGACA TGG (reversed) Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
904155942 1:28483237-28483259 ACAAAAAACTTAGCCAGACATGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906052284 1:42885592-42885614 ACAAAAAAAATCTCCACAAAAGG - Intergenic
907530451 1:55090556-55090578 TCCAAAAACCTCTCCATACTTGG + Intronic
908292194 1:62679126-62679148 ACCATACACATATCAAGACAAGG + Intronic
909161519 1:72157116-72157138 AACAAAAACATAGCCAGACAAGG - Intronic
910326435 1:86013543-86013565 ACCAAAAACTGGGCCAGACATGG + Intronic
910532478 1:88254167-88254189 ACTAAAAACATCTCCTCAAAAGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911252255 1:95590311-95590333 ACTAAAAACATGTACAGAGATGG + Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911505985 1:98752118-98752140 ACCAAAAAAATCTCAAAACCTGG - Intronic
911583347 1:99660728-99660750 ACCAAAAAATTATCCAGGCATGG + Intronic
911622848 1:100086664-100086686 ACCAAAAAAAAAGCCAGACATGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912748113 1:112262802-112262824 ACCAAAAACACCTCGAAAGAGGG + Intergenic
913045957 1:115073608-115073630 AGCAAAACCATCCCCAGTCAGGG - Intronic
914404631 1:147358419-147358441 ACCTCCAACAACTCCAGACAGGG + Intergenic
915035117 1:152915862-152915884 AGAAAAAACAGCTCCAAACATGG - Intergenic
915317938 1:155040145-155040167 ACCAAAAAATTAGCCAGACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915650717 1:157308416-157308438 TCCAAACACATGTCCAGAAAGGG + Intergenic
916528856 1:165636839-165636861 CTCAAAACCATCTCCAGCCAGGG - Intronic
916530383 1:165651110-165651132 ACCAAAGACATCTGCAGAGTGGG + Intronic
916784668 1:168077600-168077622 ACTAAAAGCATCAACAGACAGGG - Intergenic
917657185 1:177138071-177138093 ACCAAAACAAGCTCCAGACCTGG + Intronic
917696327 1:177528068-177528090 ATTTAAAACATCTCCAGAAAAGG - Intergenic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919260783 1:195190932-195190954 TCCCTAATCATCTCCAGACAGGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
923451277 1:234119899-234119921 ACCAAAAACAGCTTCAACCATGG - Intronic
1065796319 10:29311685-29311707 AAGAAAAACATCACCAGGCACGG + Intronic
1066431496 10:35356156-35356178 AAGAAAAACACCTCCAGAAAAGG - Intronic
1067291174 10:44942537-44942559 AACAAATACATGGCCAGACACGG - Intergenic
1070429199 10:76319063-76319085 TACAAAAACTTCTCCAGGCATGG - Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1073633778 10:105176563-105176585 ACAAAAAACATGGCCAGGCACGG + Intronic
1073915131 10:108394179-108394201 AACAAGAACAAATCCAGACAGGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074315021 10:112353320-112353342 ACCAACTACTTGTCCAGACATGG + Intergenic
1074838258 10:117322088-117322110 CCCAAAAACATCTCCAGGTTGGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076232531 10:128833684-128833706 AGCAAAAACATCTCTAGGAAAGG + Intergenic
1076601509 10:131659716-131659738 ACCAGAAACAGCCCCAGAAAAGG - Intergenic
1076945500 10:133646377-133646399 CCCAACACCAGCTCCAGACAGGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083957325 11:65991899-65991921 ACCCAAAAAATCGCCAGGCATGG + Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085933603 11:81117245-81117267 ACCAAATAGATCTCAATACAAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086522320 11:87683494-87683516 ATCAAAAAAATCTCCCAACAGGG + Intergenic
1087363254 11:97187312-97187334 ATCAATGACATCTCCAGAAAAGG - Intergenic
1087730365 11:101771918-101771940 ACCAAAAACATGTGGGGACATGG + Intronic
1088147387 11:106698272-106698294 AAAAAAAAAATCCCCAGACATGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088627625 11:111742303-111742325 AGCAAAATCAGCTTCAGACAAGG + Intronic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1091291908 11:134445250-134445272 ACAAAAAAAATTTCCAGGCATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092896947 12:13021245-13021267 ACAAAAAACAGCTCCTTACATGG + Intergenic
1093006403 12:14056233-14056255 ACCAAAAACATTCCAAGAAAGGG + Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096959106 12:55560066-55560088 AGCAAAAACATTTCCAAACCTGG + Intergenic
1097354932 12:58590566-58590588 ACTAAAACCAGCTCCAGACAAGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1099288351 12:80743892-80743914 ACGTAAAACATCTTCAGAAAAGG - Intergenic
1101138148 12:101766940-101766962 GCCAAAAACATGTCCAAACGTGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101300897 12:103479617-103479639 ACCAAAAACTTCTACAAACTAGG - Intronic
1101594127 12:106148725-106148747 ACCAAAAACTTCTCCAAGAAAGG + Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106193951 13:27477318-27477340 ACCACGAACATCTGCACACACGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107630763 13:42340754-42340776 CCCAAAAACATCACAAGAAAGGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1110238343 13:73239921-73239943 GCCAGAAACACATCCAGACACGG - Intergenic
1111527876 13:89495806-89495828 TCCAAAATCATCTCAAGAAAAGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1112923025 13:104639263-104639285 ACAAAAAAAATCGCCAGGCATGG + Intergenic
1113282928 13:108809919-108809941 ACCATAAACATCTATAGAAAGGG + Intronic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114295568 14:21326069-21326091 ATCAAAAACATGTATAGACAAGG - Exonic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116295876 14:43108029-43108051 AAAAAAAACAACTCCATACATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117235079 14:53765192-53765214 ACCTAAAACATCTCCAAAATGGG + Intergenic
1117909618 14:60624561-60624583 ACAAAAAAAAACTCCAGGCATGG + Intergenic
1119117651 14:72041282-72041304 ACAAGACACATCTCCAGAGAAGG - Intronic
1119875191 14:78053602-78053624 ACCAAGACCATCTCCACACCAGG - Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122317046 14:100832158-100832180 ACCAAAAACACATCCAAAGACGG + Intergenic
1202919522 14_KI270723v1_random:18180-18202 CCCAACACCAGCTCCAGACAGGG - Intergenic
1124152621 15:27195608-27195630 AACAAAAACATGGCCAGGCATGG - Intronic
1125293128 15:38171956-38171978 AACAACAACAACTCCAGTCAGGG + Intergenic
1125660354 15:41389615-41389637 ACAAAAAACTTATCCAGCCATGG + Intronic
1126378671 15:48023133-48023155 ACCAAAATAATCCTCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130550671 15:84888406-84888428 ACCCAAAACAGCTCCACAGACGG + Intronic
1130573324 15:85068503-85068525 AGCTAAAACATCCCCAGAGAAGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135481633 16:22825617-22825639 ACCAAAAACATCTCTATCCAAGG - Intronic
1135523876 16:23198580-23198602 ACAAAAAAAATCACCAGGCATGG + Intronic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140683148 16:77405203-77405225 TCCAAATTCATGTCCAGACAGGG + Intronic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140932969 16:79644885-79644907 ACAAAAACCCTCTCCAGCCAGGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141516176 16:84546806-84546828 ACCAAGAACAGTTCCAGGCATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142245040 16:88966484-88966506 ACCAAACCCATGTCCAGACGAGG + Intronic
1142965718 17:3579888-3579910 ATCAAGAACATTTCCAGATATGG - Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1144636827 17:16915448-16915470 ATCAAAAACTTAGCCAGACATGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145874850 17:28309928-28309950 ATCAAGAACATATCCAGGCATGG - Intergenic
1146106367 17:30040878-30040900 AGCAAAAACATTTCCAAATAAGG - Intronic
1146666648 17:34709477-34709499 ACCAGCAACATCTCCGGAGATGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147184144 17:38704812-38704834 TCCAAAAAGACCCCCAGACACGG + Intergenic
1147399564 17:40172076-40172098 ACAAAAAACACCACCACACATGG - Exonic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148184329 17:45630857-45630879 GCCAAAAGCATCTCCAGGGAGGG - Intergenic
1148255794 17:46130727-46130749 GCTAAATACATCTCCAGCCAAGG + Intronic
1149286346 17:55169234-55169256 ACCAAAGTCATCTCCAGAATAGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150918104 17:69456791-69456813 ATGAAAAACATCTCTAGATAAGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152557760 17:81062938-81062960 AGCACAAACATCTCCAGAGCTGG - Intronic
1153158893 18:2180385-2180407 ACTATTAACATCTCCAGCCAAGG - Intergenic
1153230750 18:2932986-2933008 AACAACAACATCTACACACATGG + Intronic
1153325297 18:3812390-3812412 ACCCAAAACATTGCCACACAAGG - Intronic
1153990911 18:10399475-10399497 ACCAAAAACATCATTATACAGGG - Intergenic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1157368348 18:47087139-47087161 ACAAAAAACATTACCAGAGAAGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1160461012 18:79038018-79038040 ACAAAATAAAACTCCAGACATGG - Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162154892 19:8671004-8671026 AAAAAAAAGATTTCCAGACATGG + Intergenic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1162874398 19:13610108-13610130 AACAAACACATTTCCAGCCAGGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164785424 19:30926635-30926657 ACCAAGATCATCTCCTGAGAAGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168423865 19:56223195-56223217 CACAAAAGCATCTCCAGACATGG + Intronic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925742093 2:7014957-7014979 ACCAAATAGATCACTAGACAAGG - Intronic
925836446 2:7951357-7951379 CCTAAAAACAGCTCCAGAGAAGG - Intergenic
926105151 2:10145223-10145245 ACTAAAAACCCCTCCAGACCTGG - Intronic
926115176 2:10208748-10208770 ACCCAACTCATCTCCAGCCATGG + Intronic
926124607 2:10264525-10264547 ACCCAAGAGACCTCCAGACAGGG - Intergenic
926451035 2:13004328-13004350 ATCAATAACATGTCCAGAAAGGG + Intergenic
927320696 2:21742069-21742091 TACAAAAACATTGCCAGACATGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929298217 2:40272020-40272042 ACCAAAAAAATAGCCAGGCATGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930468612 2:51785095-51785117 ACAAACTACATCTCAAGACAGGG - Intergenic
931258031 2:60591095-60591117 ATCAAAACCATCTTCAGAAAAGG + Intergenic
931578632 2:63748600-63748622 ACCAAAAACATACCCAGCAATGG - Intronic
935321849 2:101897027-101897049 CCCAAAAGCAGCTCCAGAAATGG + Intergenic
935817718 2:106862802-106862824 AGAAAAAACATTTCTAGACAGGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937963707 2:127484544-127484566 ACCAGAAACATCAGCACACAGGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940630980 2:156238208-156238230 ACCAAAAAAATCTCTGGACCTGG + Intergenic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
945034104 2:205689330-205689352 ACCAAACACATTTACAGACAAGG - Intronic
945427737 2:209727881-209727903 ACCCAAAACATATTCAGAAAAGG - Intronic
945701741 2:213179091-213179113 ATCAAAGACATTTCCAGGCAAGG + Intergenic
946119796 2:217500181-217500203 ACAAAAAACAACGCCAGACGTGG + Intronic
946633767 2:221701231-221701253 ACCAAAAACTTAGCCAGGCATGG - Intergenic
947287481 2:228532621-228532643 ACCAAAAAAATATCTAGAGAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948553327 2:238790732-238790754 GCCAAACACATCTACAGACATGG + Intergenic
1169401037 20:5280636-5280658 AGCAAAAACATCAAAAGACATGG + Intergenic
1169836879 20:9890288-9890310 AATAAAAACATCTCCAGACTGGG + Intergenic
1169862347 20:10165982-10166004 AAGAAAAACATCACCAGGCATGG + Intergenic
1170346563 20:15393356-15393378 AACAAAAACATCTGGAGAAAGGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171163906 20:22954000-22954022 AACAAAAAAAGCTACAGACAGGG + Intergenic
1171783488 20:29442471-29442493 CCCAACACCAGCTCCAGACAGGG - Intergenic
1171952288 20:31431216-31431238 ACCATAAACATCTAGAAACAGGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173925378 20:46777310-46777332 AACAAAATCTTCTCCAGATATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174630510 20:51952967-51952989 ACAATAAACATTGCCAGACATGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175578322 20:60079309-60079331 ACCAGAAGCATCTCTTGACAAGG + Intergenic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1178286574 21:31330383-31330405 ACCAAAAACAACTCTGCACACGG - Intronic
1178292584 21:31381674-31381696 AACAAAAAAATAGCCAGACATGG + Intronic
1178693653 21:34773057-34773079 ACCAAAAACATGGCCGGGCACGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1180589416 22:16923719-16923741 ACTAAAAAAATCTGCAGCCATGG - Intergenic
1180603992 22:17041738-17041760 ACAAAAAAAATAGCCAGACATGG + Intergenic
1181076406 22:20380689-20380711 GCCAAAAACATGTTCAAACAAGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182885351 22:33769153-33769175 AACAAAAACATCTACGGACTAGG + Intronic
1183173756 22:36206797-36206819 AGCAAAAGAATCTCCAGTCACGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183664276 22:39238380-39238402 ACCAAAAGCATCTTCAGGGACGG - Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183819698 22:40335958-40335980 AACAAAAACATGACAAGACAAGG - Intergenic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184017589 22:41797857-41797879 ACCAAAAACAGCTCCTGGCTTGG + Intronic
1184238512 22:43199485-43199507 GGCCAAAACATCCCCAGACAAGG - Exonic
1184588132 22:45461552-45461574 ACCAAAAAATTATCCAGGCATGG + Intergenic
1184751920 22:46491168-46491190 AACCGAAACATCTCCAGACATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956280426 3:67550500-67550522 ACAAAAAAAATTTCCAGGCATGG - Intronic
957081985 3:75644091-75644113 CCCAACACCAGCTCCAGACAGGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
959874348 3:111364177-111364199 ACCAAATACATCACCAGTGATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961587643 3:127947154-127947176 AAGAAAAAAATCACCAGACATGG - Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962331296 3:134481039-134481061 GCCATAAACTTCTCCAGAAATGG + Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964473271 3:157076495-157076517 AGAGAAAACATCTCCAGAGAAGG + Intergenic
964769955 3:160213860-160213882 AACAAAAACTTATCTAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
964942710 3:162178928-162178950 ACCAAAAACTTCTCAAAATATGG - Intergenic
966826212 3:183967146-183967168 AACAAGCACATCTCCAGGCAGGG - Intronic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967949136 3:194827175-194827197 ACAAAAAAAATAGCCAGACATGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969326107 4:6444887-6444909 TCCAAAAACCTCTCCAGCCTGGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
974103112 4:57439157-57439179 ACAAAAAACATAGCCAGGCATGG - Intergenic
975464219 4:74691346-74691368 AACAGAAACATCTTCAGACCAGG + Intergenic
976116377 4:81732647-81732669 ACCAAAGAGAACTCCAGATATGG - Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976752697 4:88466060-88466082 ACCAAAAACAACTCTTGACTTGG - Intronic
977377762 4:96228864-96228886 ATCAAAAACACCTCTAGAAATGG + Intergenic
977819880 4:101458897-101458919 ACCCAACTCATCACCAGACAAGG + Intronic
978281273 4:107018150-107018172 AACAAAAACAGCTCCAGCTAAGG - Intronic
978551031 4:109927427-109927449 ACCAAAGACATGTCCAGGCCGGG + Intronic
980193674 4:129559641-129559663 ACCATTAGCATCTGCAGACATGG - Intergenic
983131999 4:164031954-164031976 ACCAAAAACAACCCAAGACCAGG - Intronic
983528438 4:168784577-168784599 ACCACAAACATGTTGAGACAAGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984127427 4:175829297-175829319 ACCATAATCATATCAAGACAGGG + Intronic
984249448 4:177314401-177314423 ACAATAAGCATCTCCAGACGAGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985172129 4:187162706-187162728 ACCAATAACATTTCCAGAGAAGG + Intergenic
985448886 4:190046889-190046911 CCCAACACCAGCTCCAGACAGGG - Intergenic
985952544 5:3234672-3234694 ACAAAACACACATCCAGACATGG - Intergenic
986120414 5:4830697-4830719 GTCAAGAACATCTCCAAACATGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987095063 5:14542389-14542411 ACCACAAACATCTGCAGTCTAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988384187 5:30539861-30539883 ACCCAAAACATTCCCAGCCATGG + Intergenic
988404355 5:30805032-30805054 ACCAAAGCCCTTTCCAGACACGG - Intergenic
988936263 5:36086009-36086031 ACCAAAATCATATCAAGTCATGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989388143 5:40873360-40873382 ACCAAAAAATTAGCCAGACATGG + Intergenic
989639708 5:43571056-43571078 ACCAGAAACATCTACAGGCTAGG - Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990391750 5:55329462-55329484 ATCAAAAACATGGCCAGGCATGG - Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
992995906 5:82332577-82332599 AGCAAACTCATCACCAGACAGGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
994043905 5:95286343-95286365 ACCAAAAACCTCTCCATATGGGG - Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996042986 5:118837474-118837496 ACCAATAACAACTACAGGCAAGG + Intronic
997127641 5:131244413-131244435 ACAAAAAACATCTTCAGGCCGGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
998438868 5:142139062-142139084 ACAAAAAAAATAGCCAGACATGG + Intronic
998783134 5:145680673-145680695 ACCAAAAACATCAGAAGCCAAGG - Intronic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001896516 5:175386847-175386869 ACCACACACAACTCCAAACAGGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003808642 6:9754862-9754884 AAAAAAAACATCTCCATAGATGG + Intronic
1003978139 6:11363659-11363681 ACCAACAACATCCCCAGTTACGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007118054 6:39357809-39357831 GCCAAAAACAAATCTAGACATGG + Intronic
1007500294 6:42291843-42291865 AGTAAAAACTTGTCCAGACAGGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1011282258 6:85688870-85688892 ACCAAAAGAATACCCAGACATGG - Intergenic
1011411563 6:87071703-87071725 TCAAAAAACATCCCAAGACAGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015332271 6:131994421-131994443 ACAAAAAACATAGCCAGGCATGG - Intergenic
1015419585 6:132990817-132990839 TCCAAAAGCATCTTCAAACAAGG + Intergenic
1015803573 6:137086169-137086191 AGGAAAAACATCTCCATATATGG + Intergenic
1017515942 6:155155768-155155790 AACAAAAACATTTCCAGGCTGGG - Intronic
1018723634 6:166592894-166592916 ACCAAAAACATCAGCACAAAAGG + Intronic
1018896331 6:168020345-168020367 TACAAAGACATTTCCAGACATGG + Intronic
1019794678 7:3041069-3041091 ACCAAAAAATTAGCCAGACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023802678 7:43848582-43848604 ACCAATCACATCTCCAGCCTGGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1026732197 7:72921731-72921753 ACCATAAACAACTGTAGACATGG - Intronic
1027111770 7:75445616-75445638 ACCATAAACAACTGTAGACATGG + Intronic
1027284000 7:76630147-76630169 ACCATAAACAACTGTAGACATGG + Intergenic
1027444258 7:78254667-78254689 AGGAAAAACACCTGCAGACAGGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027915040 7:84306931-84306953 AAAAAAAAAATCTCCAGACTTGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031670245 7:124533916-124533938 ACCAAAACAATATCCAGAGAAGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032765675 7:134990570-134990592 AACAAAAACATGTTCACACAAGG - Intronic
1034134955 7:148758461-148758483 ACAAAAAAAATATCCAGGCATGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036510431 8:9395012-9395034 AAAAAAAAAATGTCCAGACAAGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038131314 8:24734620-24734642 ACCAATAAAATTTCAAGACAAGG + Intergenic
1038779479 8:30557800-30557822 TCCAAAAACATGTCCAGTGATGG + Intronic
1039622197 8:39008324-39008346 ACCAAAAAATTAGCCAGACATGG - Intronic
1041561425 8:59223736-59223758 AAGAAAAACATCTTCAGAAAGGG - Intergenic
1042593999 8:70425814-70425836 ACCAAAGGCATCACCAGGCATGG - Intergenic
1043505513 8:80898144-80898166 AACAAAAACATGTCCAGAATGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043544022 8:81295094-81295116 AACAAAAACTTATCCAGGCATGG + Intergenic
1045328116 8:101132274-101132296 AGCTAGAACATCTCTAGACAAGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1045914409 8:107449248-107449270 ACCAAAAACATCACCAAGGAGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047567680 8:126063320-126063342 ACCAAAAAAATTGCCAGGCATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048561901 8:135548186-135548208 ACCAAGCACTTCTCTAGACATGG + Intronic
1048949135 8:139478620-139478642 ACCAAAAGCTGCTCCAGGCAGGG - Intergenic
1049716900 8:144097220-144097242 ATCATCAACATCTGCAGACAAGG - Exonic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051850149 9:21497067-21497089 ACCAAAAACATGAACAGAAAAGG + Intergenic
1055330714 9:75180365-75180387 ACAAAAAAAATCTCCATAAATGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056693814 9:88829727-88829749 TTCAAAATCAACTCCAGACATGG + Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1059948032 9:119432728-119432750 AAAAAAAAAATCTCCAAACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060322698 9:122579392-122579414 TCCAAAGCAATCTCCAGACAAGG - Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061430040 9:130525020-130525042 ACAAAAAACTTAGCCAGACATGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062080638 9:134621594-134621616 TACAAAAGCATCCCCAGACATGG - Intergenic
1203652254 Un_KI270751v1:136814-136836 TACAAAAACTTATCCAGACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185852538 X:3502522-3502544 ATCAAAGACATGTTCAGACATGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186886987 X:13923644-13923666 ATGAATAACATCTCCAAACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1188876847 X:35441023-35441045 ACCAAAAACATATAGAGAGAAGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190190142 X:48270224-48270246 ACAAAGAACATCTCCTGACTGGG + Intronic
1190377043 X:49798147-49798169 ACATAAAACACCTCCATACAGGG - Intergenic
1190452477 X:50595491-50595513 ACCAAAGAAATCTCCTGAAATGG - Exonic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1194190188 X:90825490-90825512 AATATAAACATCTCCAGAGAAGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1198393893 X:136204205-136204227 ACCAAATAAATCTCCAGTAACGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199290791 X:146102846-146102868 ACCAAAAACGTAGCCAGAGAAGG - Intergenic
1199448550 X:147954359-147954381 ACCAAACCCAACTCCAGCCAGGG - Intergenic
1200211230 X:154347471-154347493 ACCTCAGACATCTGCAGACAAGG - Intergenic
1200536785 Y:4407588-4407610 AATATAAACATCTCCAGAGAAGG - Intergenic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic