ID: 1078460403

View in Genome Browser
Species Human (GRCh38)
Location 11:11510963-11510985
Sequence TCTAACATGAGGATGGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078460396_1078460403 18 Left 1078460396 11:11510922-11510944 CCCAGACTTCTGTGTACCACCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124
1078460398_1078460403 2 Left 1078460398 11:11510938-11510960 CCACCTCTACATGCCTCTCTGTA 0: 1
1: 0
2: 1
3: 20
4: 250
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124
1078460395_1078460403 23 Left 1078460395 11:11510917-11510939 CCTGACCCAGACTTCTGTGTACC 0: 1
1: 0
2: 0
3: 14
4: 526
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124
1078460399_1078460403 -1 Left 1078460399 11:11510941-11510963 CCTCTACATGCCTCTCTGTAGCT 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124
1078460397_1078460403 17 Left 1078460397 11:11510923-11510945 CCAGACTTCTGTGTACCACCTCT 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124
1078460394_1078460403 27 Left 1078460394 11:11510913-11510935 CCTTCCTGACCCAGACTTCTGTG 0: 1
1: 0
2: 2
3: 26
4: 285
Right 1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078460403 Original CRISPR TCTAACATGAGGATGGTGCC CGG Intronic
901182483 1:7351211-7351233 TCAGACATCAGGATCGTGCCTGG - Intronic
902364671 1:15964420-15964442 TCTAACATGACAATGGGGCCAGG + Intronic
902380998 1:16052142-16052164 CCTAACATGAGGCTGGCCCCTGG + Intronic
902685673 1:18075868-18075890 TATAAAATGAGGATGATGCCAGG - Intergenic
903137727 1:21320293-21320315 TATAAAATGGGGATGGTGACAGG + Intronic
908250870 1:62264630-62264652 CCTAACATGGGTGTGGTGCCGGG + Intronic
915777947 1:158511672-158511694 TCTAAAATGAGCATGGTGACTGG - Intergenic
923628792 1:235636055-235636077 TCTAGCAAGAGGAGGGTTCCTGG - Intronic
923920345 1:238557114-238557136 TCTCTCATGAGGATTGTACCTGG - Intergenic
1066182294 10:32974807-32974829 TCTAAAATCAGGTTGGTGGCTGG - Intronic
1067691845 10:48507082-48507104 GCTAAGATGATGATGGTGCTTGG - Intronic
1074800948 10:117000677-117000699 ACTACCATGAGGATGCTGACCGG - Intronic
1078460403 11:11510963-11510985 TCTAACATGAGGATGGTGCCCGG + Intronic
1081048216 11:38303631-38303653 TCAAACATGGGGATGGTCCTGGG - Intergenic
1083221569 11:61256355-61256377 TCTAACCTGCGGCTGGTGGCAGG - Intergenic
1088439310 11:109851395-109851417 TCAAAGATGAGAAGGGTGCCAGG + Intergenic
1091564913 12:1641086-1641108 TCAAAAATGAGAATGGTGGCCGG + Intronic
1096110569 12:49026843-49026865 TCTGTCATGAGGAGGGTGACGGG - Exonic
1097996067 12:65888904-65888926 TCTAACGGGAGGGTGGTCCCTGG - Intronic
1098481789 12:70970202-70970224 TCCAAAAAAAGGATGGTGCCGGG + Intergenic
1099649632 12:85408898-85408920 TTAAAAATGAGAATGGTGCCAGG + Intergenic
1100227490 12:92573860-92573882 TCTAAGATCAGGTTGGTACCAGG + Intergenic
1100990390 12:100245163-100245185 TTTAAAATAAGGATGGGGCCAGG - Intronic
1102004056 12:109577611-109577633 TCTAAAATGAGGATTTTGGCTGG - Intronic
1105329093 13:19398348-19398370 TCTAGCAGGGGGATGATGCCAGG - Intergenic
1105509292 13:21037896-21037918 TCTGGCCTCAGGATGGTGCCTGG - Intronic
1105862764 13:24430921-24430943 TCTAGCAGGGGGATGATGCCAGG + Intronic
1106197110 13:27503360-27503382 TCAAAAATGAGGCTGGTGTCAGG + Intergenic
1108283890 13:48886784-48886806 TCAAACATTAGGAGGGAGCCTGG - Intergenic
1113064126 13:106356909-106356931 TCTGAGATGAGGATGCTGGCAGG - Intergenic
1116129548 14:40837299-40837321 TCTCAAATGTGAATGGTGCCTGG - Intergenic
1116940088 14:50782998-50783020 TCGAAGATGAGGATGCTGCCTGG - Intronic
1118442188 14:65821994-65822016 TCAAACTTGAAGAAGGTGCCTGG - Intergenic
1118926009 14:70189925-70189947 TCTAAAATGAGCCTGGTGGCTGG + Intergenic
1119405125 14:74393899-74393921 GCTAAGATGAGTTTGGTGCCGGG - Intergenic
1121577104 14:94997248-94997270 TCTAACATCAAGGTGTTGCCTGG + Intergenic
1121674123 14:95738685-95738707 TCTAATATGAGGCTGCTACCAGG - Intergenic
1122903051 14:104789808-104789830 TCTAACAGGGAGATGGTTCCTGG - Intronic
1128101013 15:64999847-64999869 CCTAACATGAGCAGAGTGCCTGG + Intergenic
1129616196 15:77100279-77100301 TCTACAATGAGGAAGCTGCCAGG + Intergenic
1130389174 15:83439820-83439842 TTAAAAATGAGGATGGGGCCGGG - Intergenic
1134485111 16:14651766-14651788 TCTTCCATGAGGAGGGTGCGGGG - Intronic
1135129098 16:19837460-19837482 TTTACCATCAGGATGGTTCCTGG + Intronic
1136225318 16:28856554-28856576 TCTAAGAGGAGGATGGGGTCTGG + Intronic
1137384182 16:48026244-48026266 TGTAACTTGAGCATTGTGCCTGG + Intergenic
1138051326 16:53781733-53781755 ACTAACATGATTATGGTGCTTGG + Intronic
1157069170 18:44385943-44385965 TCTAGCATGAGCATAATGCCTGG + Intergenic
1158863246 18:61613688-61613710 TCCAACAAGAGTATGGTGCAAGG - Intergenic
1158915960 18:62129691-62129713 TCCAACATCAGTATAGTGCCTGG + Intronic
1162608769 19:11732917-11732939 ACTAACTTGAGGATGGGGACTGG - Intronic
1164582847 19:29445520-29445542 TTTAACATGAGGATAGTAACAGG + Intergenic
1165129992 19:33625876-33625898 TTTAAATTGAGGTTGGTGCCTGG + Intronic
1165180608 19:33964169-33964191 TCTAACATGAGTAAGGTTCCAGG + Intergenic
1165747356 19:38237876-38237898 TCAAGAATGAGGATGATGCCAGG + Intergenic
1168233122 19:55045630-55045652 CTTAACCTGAGGCTGGTGCCAGG - Intronic
927611351 2:24544444-24544466 TCTAAAATGAGGATTCTGGCTGG + Intronic
927919383 2:26960482-26960504 TTTAAGATAAGGATGGTGGCCGG - Intergenic
931434736 2:62236467-62236489 TGTTACATGAGGAAGGGGCCGGG - Intergenic
934619632 2:95796376-95796398 TGTAAAATGAGGATAGTGGCGGG + Intergenic
934641256 2:96028181-96028203 TGTAAAATGAGGATAGTGGCGGG - Intronic
935984272 2:108657674-108657696 TTTAACATGAGGCTTGGGCCAGG + Intronic
936136710 2:109901322-109901344 TTTAACATGAGGCTTGGGCCAGG + Intergenic
936207987 2:110470163-110470185 TTTAACATGAGGCTTGGGCCAGG - Intronic
936634718 2:114242802-114242824 ACTAACATGAGAATAGTACCAGG + Intergenic
937412352 2:121687518-121687540 TGAAAGGTGAGGATGGTGCCAGG - Intergenic
937438676 2:121899258-121899280 TCAAACATGAGGATGGGGCGGGG + Intergenic
938662840 2:133505016-133505038 TCTATCAGGAGCATGGTGCCTGG + Intronic
940148757 2:150576403-150576425 TCCAAAATTTGGATGGTGCCAGG + Intergenic
946497995 2:220215609-220215631 TCTGAGATGAGCATGGTGGCAGG + Intergenic
947084650 2:226437434-226437456 TCTATCATGAGGACTGTACCAGG + Intergenic
1172878279 20:38179791-38179813 ACTATCATGAGGACAGTGCCGGG - Intergenic
1174184251 20:48694456-48694478 TCTAACATGGGGTTGGAGGCAGG + Intronic
1177019414 21:15835408-15835430 TGTAAAATGAGGATGGGGCAAGG - Intronic
1178440741 21:32596062-32596084 TCTCACATGTGGGTGGTGTCCGG + Intronic
1178635890 21:34302822-34302844 TCTAACATGTGGAAGGTGTTAGG + Intergenic
1182287933 22:29259094-29259116 TCAGACATGTGCATGGTGCCAGG - Exonic
1183057357 22:35315165-35315187 TCTAGCGGGAGGATGGTGGCCGG + Intronic
949140605 3:628277-628299 AGTACCATGAGGATGCTGCCAGG + Intergenic
953425487 3:42793616-42793638 TCTAACCTGAGGATGGTCTTGGG + Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
957914855 3:86675600-86675622 TCTATCATGAGAATAGTGCTAGG - Intergenic
959555369 3:107711336-107711358 TCAGAAATGAGAATGGTGCCTGG + Intronic
963113785 3:141708486-141708508 GCTCACAGGAGGAAGGTGCCTGG + Intergenic
964323367 3:155520958-155520980 TCTAACTCCAGGGTGGTGCCGGG + Intronic
964468904 3:157030712-157030734 TCTCTCATGAGGTTGGTGTCAGG + Intronic
967601733 3:191398602-191398624 TATAACATGATAATGATGCCTGG + Intronic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
970883618 4:20961329-20961351 TAGAACATTAGGATGGTGGCTGG - Intronic
974204911 4:58689521-58689543 TCTAAAATGAAGATGTTGGCAGG + Intergenic
975257184 4:72251675-72251697 TCAAGAATGAGAATGGTGCCTGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
985079523 4:186250276-186250298 TCTCAGATGTGGATGTTGCCAGG + Exonic
987803104 5:22723602-22723624 TCTAGAATGATGATTGTGCCAGG - Intronic
988995338 5:36709607-36709629 TATCAGATGAGGATGGTGCATGG - Intergenic
990503837 5:56424848-56424870 CCTAACATGAGGATGGGGCTAGG - Intergenic
991461639 5:66864779-66864801 TCTAACATGAAGATGTTGGCAGG - Intronic
995237367 5:109844607-109844629 TCTAACATCAGGGTGTTGGCAGG + Intronic
995281522 5:110340888-110340910 GCAATCATGTGGATGGTGCCAGG + Intronic
997631146 5:135369723-135369745 TCCTCCATGAGGATGCTGCCAGG + Intronic
999879718 5:155848387-155848409 TCTGAAAAGAGGTTGGTGCCAGG + Intergenic
1001427602 5:171633930-171633952 TGAAACAGGAGGATGGAGCCTGG - Intergenic
1001629741 5:173165825-173165847 TCTAACAGAATGCTGGTGCCTGG - Intergenic
1003576328 6:7299401-7299423 TCTAAAATGACAGTGGTGCCGGG + Intronic
1004143222 6:13040640-13040662 TCTCACACGAGGGTGGTGGCTGG - Intronic
1006301105 6:33193850-33193872 TCTAACTTGGGGAAGGGGCCTGG - Exonic
1006526046 6:34605938-34605960 GCTAAGGTGATGATGGTGCCTGG - Intronic
1006801340 6:36761575-36761597 GCTAGCATGAGGACAGTGCCAGG + Intronic
1007052900 6:38851088-38851110 TGTCACAAGAGGATGGTGTCAGG + Intronic
1012255440 6:97026440-97026462 TCTTAGATTAGGAAGGTGCCAGG + Intronic
1016898187 6:149074583-149074605 TCGAAAAGGAGGATGGAGCCAGG + Exonic
1018582900 6:165323178-165323200 TTTAACATGAAGCTGGTGACTGG - Intergenic
1019802191 7:3096217-3096239 TCTAAAATGTGGATGTTGCTGGG + Intergenic
1021847822 7:24779749-24779771 GCGAGCCTGAGGATGGTGCCAGG - Intergenic
1023551741 7:41377219-41377241 TCAAGCACTAGGATGGTGCCTGG - Intergenic
1024695666 7:51854319-51854341 TATAACATGAGAATGGTGTAAGG + Intergenic
1024972393 7:55082666-55082688 TCTCAGATGAGGCTGCTGCCCGG - Intronic
1025854938 7:65268552-65268574 TCTAAGATGAGCATATTGCCTGG + Intergenic
1028125168 7:87104539-87104561 TATAACCTGAGGATGGTGCAGGG - Intergenic
1031971140 7:128065931-128065953 TCTTCCCTGAGGCTGGTGCCAGG - Intronic
1035235872 7:157497464-157497486 GCTCACAGGAGGATGGTGACAGG + Intergenic
1038854875 8:31320240-31320262 TCTAAAACCAGGATGGTCCCAGG - Intergenic
1039747419 8:40441590-40441612 TCCAACATGAAGGTGGTGACAGG + Intergenic
1041374993 8:57203949-57203971 TCTGACGTGAGCATGGTACCAGG - Intergenic
1044237806 8:89852014-89852036 TTTAAAATGAGGATAGTGGCTGG - Intergenic
1045955473 8:107900799-107900821 TCTAGCATGTCCATGGTGCCGGG + Exonic
1048807022 8:138250452-138250474 TCTCAAATGAAGATGGTACCAGG - Intronic
1049115105 8:140679318-140679340 TTTAAAATGAGCATGGGGCCAGG - Intronic
1049360315 8:142209656-142209678 TCCCACATGAGGAGGGTGCCAGG + Intergenic
1056770485 9:89474957-89474979 TAGAACCTGAGGAGGGTGCCTGG + Intronic
1062198656 9:135288738-135288760 TCCAAAAGTAGGATGGTGCCTGG + Intergenic
1186331883 X:8543091-8543113 ACAAAGATGAGCATGGTGCCTGG + Intronic
1192435248 X:71139365-71139387 ACCAGAATGAGGATGGTGCCTGG + Intronic
1199495006 X:148442976-148442998 TAAAACATGAGAATGGTGTCAGG - Intergenic
1199996672 X:153030488-153030510 TGGAAAATGAGGATGGGGCCAGG + Intergenic
1201430731 Y:13899527-13899549 ACAAAGATGAGCATGGTGCCTGG - Intergenic
1201782997 Y:17743856-17743878 TCTAAAATAGGGATGGTGCCAGG - Intergenic
1201818556 Y:18162131-18162153 TCTAAAATAGGGATGGTGCCAGG + Intergenic
1202602809 Y:26611258-26611280 TCTAGCAGGGGGATGATGCCAGG + Intergenic