ID: 1078460597

View in Genome Browser
Species Human (GRCh38)
Location 11:11512335-11512357
Sequence CCTCCTGGCGGATCTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078460597_1078460604 11 Left 1078460597 11:11512335-11512357 CCTGACCCAGATCCGCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460597_1078460603 -2 Left 1078460597 11:11512335-11512357 CCTGACCCAGATCCGCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078460597 Original CRISPR CCTCCTGGCGGATCTGGGTC AGG (reversed) Intronic