ID: 1078460603

View in Genome Browser
Species Human (GRCh38)
Location 11:11512356-11512378
Sequence GGACAGACTGTTTTTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 262}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078460593_1078460603 23 Left 1078460593 11:11512310-11512332 CCCATCTCACAGCTGTCAGACTC 0: 1
1: 0
2: 0
3: 21
4: 192
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460600_1078460603 -8 Left 1078460600 11:11512341-11512363 CCAGATCCGCCAGGAGGACAGAC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460594_1078460603 22 Left 1078460594 11:11512311-11512333 CCATCTCACAGCTGTCAGACTCC 0: 1
1: 1
2: 2
3: 23
4: 411
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460595_1078460603 1 Left 1078460595 11:11512332-11512354 CCGCCTGACCCAGATCCGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 189
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460599_1078460603 -7 Left 1078460599 11:11512340-11512362 CCCAGATCCGCCAGGAGGACAGA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460597_1078460603 -2 Left 1078460597 11:11512335-11512357 CCTGACCCAGATCCGCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262
1078460592_1078460603 24 Left 1078460592 11:11512309-11512331 CCCCATCTCACAGCTGTCAGACT 0: 1
1: 0
2: 3
3: 23
4: 260
Right 1078460603 11:11512356-11512378 GGACAGACTGTTTTTCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078460603 Original CRISPR GGACAGACTGTTTTTCCTTG TGG Intronic