ID: 1078460604

View in Genome Browser
Species Human (GRCh38)
Location 11:11512369-11512391
Sequence TTCCTTGTGGAAATAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078460595_1078460604 14 Left 1078460595 11:11512332-11512354 CCGCCTGACCCAGATCCGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 189
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460601_1078460604 -1 Left 1078460601 11:11512347-11512369 CCGCCAGGAGGACAGACTGTTTT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460600_1078460604 5 Left 1078460600 11:11512341-11512363 CCAGATCCGCCAGGAGGACAGAC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460602_1078460604 -4 Left 1078460602 11:11512350-11512372 CCAGGAGGACAGACTGTTTTTCC 0: 1
1: 0
2: 1
3: 83
4: 757
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460599_1078460604 6 Left 1078460599 11:11512340-11512362 CCCAGATCCGCCAGGAGGACAGA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231
1078460597_1078460604 11 Left 1078460597 11:11512335-11512357 CCTGACCCAGATCCGCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1078460604 11:11512369-11512391 TTCCTTGTGGAAATAGTTCATGG 0: 1
1: 0
2: 2
3: 14
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078460604 Original CRISPR TTCCTTGTGGAAATAGTTCA TGG Intronic