ID: 1078463447

View in Genome Browser
Species Human (GRCh38)
Location 11:11532699-11532721
Sequence CAGCCTTGAAGCAGCTCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078463447_1078463453 15 Left 1078463447 11:11532699-11532721 CCCGCTGAGCTGCTTCAAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1078463453 11:11532737-11532759 CATGCATGATATTAAATTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078463447 Original CRISPR CAGCCTTGAAGCAGCTCAGC GGG (reversed) Intronic
900398087 1:2461492-2461514 CTGCCCTGAATCATCTCAGCAGG - Intronic
902942661 1:19811814-19811836 CAGCCCTTTAGAAGCTCAGCTGG - Intergenic
905025720 1:34847957-34847979 AAGCTCTGGAGCAGCTCAGCAGG - Intronic
905078740 1:35298081-35298103 CAGCCTTGAAGCTGGTGGGCTGG - Intronic
905395968 1:37666851-37666873 CAGCCTGGAAGCTGCTCCTCTGG + Intergenic
907798542 1:57741770-57741792 CAGTCTTGCACGAGCTCAGCTGG + Intronic
908825900 1:68132360-68132382 CAGACATCAAGAAGCTCAGCTGG + Intronic
909111801 1:71488454-71488476 CAAACTTGAAACAGTTCAGCTGG - Intronic
913329216 1:117653389-117653411 CTGCCTAGATGCCGCTCAGCTGG - Intergenic
915279198 1:154810691-154810713 CAACCTTGCAGCAGCTCTGGAGG - Intronic
918917968 1:190669916-190669938 TTGCCTTCAAGCACCTCAGCAGG + Intergenic
920925612 1:210338686-210338708 CAACCATGAAGCAGCAAAGCTGG + Intronic
922580386 1:226693000-226693022 CACACTTGAAGCAGCTCATCAGG - Intronic
923094943 1:230767688-230767710 CATCAATGAAGCAGCCCAGCAGG - Exonic
923171105 1:231418584-231418606 CAGACTTGAACCACCTCACCTGG - Intronic
923537665 1:234865377-234865399 AAGCCATGCAGCAGATCAGCAGG - Intergenic
1062927545 10:1328100-1328122 CCCACATGAAGCAGCTCAGCAGG + Intronic
1063219231 10:3950794-3950816 CATCCCTGCAGCAGCTCACCAGG + Intergenic
1063537650 10:6900806-6900828 CAGCATGTTAGCAGCTCAGCTGG + Intergenic
1065115416 10:22478506-22478528 CAGTCTTGAAGTAGCCCAGGTGG - Intergenic
1066188095 10:33030277-33030299 CAGCCTTCAGGCAGAGCAGCAGG + Intergenic
1067274027 10:44818848-44818870 CAGCCTCTCAGCAGCTCAGCTGG - Intergenic
1068251117 10:54442106-54442128 CAGCCTTGAAGCAGACATGCAGG - Intronic
1070921275 10:80187952-80187974 AACCCTTGCAGCAGCTCTGCCGG + Intronic
1076255756 10:129023231-129023253 CCGCCTTGAGCCAGCCCAGCTGG + Intergenic
1076555957 10:131321530-131321552 CAGCCTGAAAGCAGCCCCGCAGG + Intergenic
1076717984 10:132376494-132376516 AGGCGTTGGAGCAGCTCAGCCGG + Exonic
1077302602 11:1854179-1854201 CGGCCTAGGAGCAGGTCAGCGGG + Intronic
1077474687 11:2780731-2780753 CAGCCCTGAACAAGCTCAGCTGG - Intronic
1078463447 11:11532699-11532721 CAGCCTTGAAGCAGCTCAGCGGG - Intronic
1079226942 11:18614943-18614965 CAACCTGCAAGCAGCTCAGGTGG - Exonic
1079323832 11:19474896-19474918 CAGCCTTGCAGCAGATGAGACGG - Intronic
1081519642 11:43869449-43869471 CAGCTTTGAACAAGCTCACCAGG - Intergenic
1081575932 11:44318513-44318535 CAGCCAGTAAGCAGCACAGCTGG - Intergenic
1081811282 11:45915528-45915550 CAGCCTTGAACCAGAGCAGCAGG + Exonic
1083297117 11:61720778-61720800 CAGCGATCATGCAGCTCAGCAGG - Exonic
1083895940 11:65619754-65619776 CAGCCTGCAGGAAGCTCAGCGGG + Exonic
1083919843 11:65776466-65776488 CATCCTTGCAACAGCTCTGCAGG - Exonic
1084550734 11:69840348-69840370 CAGCAGTGAAGCAGGACAGCTGG - Intergenic
1085280379 11:75326083-75326105 ATGCCTTGAAGGAGCTCTGCAGG + Intronic
1088687765 11:112298942-112298964 CAGCCAGGAAGTAGCACAGCAGG - Intergenic
1089364112 11:117910565-117910587 CAGCCCTGAAGCAGGCCTGCTGG + Intronic
1089731619 11:120522919-120522941 CAGCCACGGAGCAGCACAGCTGG + Intronic
1089917380 11:122171393-122171415 CAGCCTTGAGGCACCGCACCTGG - Intergenic
1090520367 11:127472907-127472929 CATCTTGGAAGCAGCTGAGCTGG - Intergenic
1091931790 12:4402439-4402461 CAGCCCTGAAGCAGCTCTCAAGG - Intergenic
1093089370 12:14904355-14904377 CAGACTAGAGGCAGCTGAGCTGG + Intronic
1095446423 12:42287314-42287336 TAGCCATGAAGAAGCTAAGCGGG + Intronic
1100385969 12:94104883-94104905 CAGCCTTGGAGCAGTTCAAATGG + Intergenic
1101912215 12:108868482-108868504 GAATCTGGAAGCAGCTCAGCTGG - Intronic
1102224137 12:111216094-111216116 CAGCCGTGAAGCAGATGAGGCGG + Intronic
1102261771 12:111447418-111447440 CAGAGTGAAAGCAGCTCAGCTGG + Exonic
1102918269 12:116771962-116771984 CAGCCCTGAAGGAACTCAGGAGG - Intronic
1103081943 12:118031215-118031237 CAGCAATGAGGGAGCTCAGCTGG - Exonic
1103733609 12:123044391-123044413 CAGCCTCTAAGCATCTCAGGGGG - Intronic
1103911836 12:124356218-124356240 CAGCTGTAAAGCAGCACAGCCGG - Intronic
1103938455 12:124489040-124489062 TAGGCTTGAAGCAGGTCACCAGG + Intronic
1103996546 12:124833917-124833939 CTGCTTTCAAGCAGCTCAGCGGG + Intronic
1105298995 13:19116743-19116765 CTGGCTTGGAGCAGCTAAGCAGG + Intergenic
1105374878 13:19834563-19834585 CAGGCGTGAAGCACCTCACCTGG + Intronic
1105501916 13:20980328-20980350 CAGCCCTGACCCAGCACAGCTGG - Intronic
1106898516 13:34330919-34330941 CAGTATTGAAGGAGCTCATCAGG - Intergenic
1107731867 13:43356834-43356856 CAGCCCTGCAGCACCTCATCTGG + Intronic
1108103764 13:46986343-46986365 CAGGCTTGAGACAGCACAGCTGG + Intergenic
1108378195 13:49833273-49833295 GAGCCATGAAGCAGCACACCTGG + Intergenic
1110598134 13:77341372-77341394 CAGCCTGGAAGGAGCCCAGGTGG - Intergenic
1111157652 13:84349648-84349670 CAGGCGTGAACCACCTCAGCTGG - Intergenic
1112091963 13:96091379-96091401 CAGCCTTGTAGCTGCAAAGCGGG + Exonic
1120018220 14:79498380-79498402 CAGCCTTGACTCACCTGAGCGGG + Intronic
1120521285 14:85530573-85530595 CAGCGTAGCAGCAGCTCGGCCGG - Intronic
1122264738 14:100541328-100541350 CAGCCATGGGGCAGCTCAGGTGG - Intronic
1122366643 14:101198408-101198430 CAGCCTTGCCTCAGCTCTGCTGG - Intergenic
1122463739 14:101916729-101916751 CAGGGGTGAAGCAGGTCAGCAGG + Intronic
1123714144 15:23014138-23014160 CAGCCTGGAGGCATGTCAGCTGG - Intronic
1124420507 15:29517060-29517082 CAGCATGGCAGCAGCTCAGGAGG + Intronic
1125005338 15:34810755-34810777 CACTCTTGAAGTAGCTCATCTGG - Intergenic
1129452048 15:75656577-75656599 CAGGGTTGAATCAGTTCAGCAGG + Intronic
1129671597 15:77610832-77610854 CAGCCTTGAGGCATCCCAGAGGG + Intergenic
1129701128 15:77769225-77769247 CAGCCTTGGCACAGCTCCGCTGG - Intronic
1130653106 15:85773494-85773516 CTGCCTCCAGGCAGCTCAGCGGG + Intronic
1132645995 16:999562-999584 GTGGCTTGAAGCAGCTCAGCTGG - Intergenic
1132919376 16:2377202-2377224 TAGCCTTGAAGATGCTGAGCAGG + Intergenic
1133017504 16:2951028-2951050 CAGCCCGGCAGCAGCTCAGCGGG + Exonic
1134089523 16:11384164-11384186 CAGCCCTCAAGAACCTCAGCTGG + Intronic
1135347943 16:21705259-21705281 CAGCCTGGAAGCCCCTCAGGTGG - Exonic
1136005721 16:27327352-27327374 CAGCCTGGAAGCGACCCAGCAGG - Intronic
1136105407 16:28026569-28026591 CAGGCTGGACGCAGCTCAGCTGG + Intronic
1136358262 16:29760864-29760886 CAGCCTTCAGGCCACTCAGCTGG + Intergenic
1137263373 16:46849123-46849145 CAGGCTCAAAGCAGCTCAGGAGG + Intergenic
1138212814 16:55177386-55177408 CAGCCTTAGAGCAGTTCTGCTGG - Intergenic
1139307985 16:66004307-66004329 CAGCCAGGAAGCAGCAGAGCTGG + Intergenic
1140594698 16:76395187-76395209 CAGACTTGAAGCTGCTTAGAGGG + Intronic
1140606836 16:76549148-76549170 CAGCCTAGAAGAATCTCAGGGGG + Intronic
1141109726 16:81262361-81262383 CAGCCTGCAAGCAGCTTACCAGG + Intronic
1141246682 16:82314329-82314351 CAGGCTTGACTGAGCTCAGCAGG - Intergenic
1141391462 16:83668041-83668063 CAGCCATGACGCAGCTCTGCTGG + Intronic
1141692306 16:85603186-85603208 CAGCTTTGAGGGAGCTCAGCTGG + Intergenic
1142307076 16:89291738-89291760 CAGCCTTGCAGCACCACAACAGG + Intronic
1142354285 16:89594958-89594980 CAGTCTTGTGGCAGCACAGCGGG + Intronic
1142363455 16:89637941-89637963 CAGCCTCGAAGACCCTCAGCAGG - Exonic
1142510516 17:389790-389812 CAGCCTTGAAGAAGCCCCGGGGG + Intergenic
1147976806 17:44252704-44252726 CAGTCATGGAGCAGCTGAGCTGG + Intronic
1148213120 17:45820018-45820040 CAGCACGGCAGCAGCTCAGCTGG + Intronic
1148341633 17:46876766-46876788 CACCCTTCAAGCTGCCCAGCCGG + Exonic
1151059266 17:71072085-71072107 CACCCTTGACGCAGCCAAGCTGG + Intergenic
1151269154 17:72979663-72979685 CAGCCTCCTTGCAGCTCAGCTGG - Intronic
1151625553 17:75273309-75273331 CAGCCTTGAACCCACCCAGCTGG - Exonic
1151679378 17:75615534-75615556 CAGCCTGGATGCAGGGCAGCTGG + Intergenic
1152596384 17:81239654-81239676 CAGCGGCGAAGCAGCTCCGCAGG - Exonic
1153331561 18:3879903-3879925 CAGCCTGGAAGGAGTTCCGCTGG + Exonic
1155531055 18:26767019-26767041 GATCCTTCAAGCACCTCAGCTGG - Intergenic
1155853363 18:30800511-30800533 AAGGCCTGAAGCAGCACAGCAGG + Intergenic
1156041799 18:32831315-32831337 CATGCTTGAAGCATTTCAGCAGG - Intergenic
1157072478 18:44424063-44424085 GCCCCTTTAAGCAGCTCAGCAGG - Intergenic
1157353059 18:46908250-46908272 CAGCCTTGAGCCACCTCACCAGG + Intronic
1158017719 18:52804447-52804469 AATCCTTAAAACAGCTCAGCTGG + Intronic
1159658469 18:71061970-71061992 CTGCACTGAAGCAGCTCACCAGG - Intergenic
1161340719 19:3740567-3740589 CAGCCTGGAAGCTGCCCAGAGGG + Exonic
1162801367 19:13112594-13112616 CAGCCTGGAGGAAGCTGAGCAGG + Intronic
1162866010 19:13547639-13547661 CAGCCTGGAAGCAGCAAATCAGG + Intronic
1163283609 19:16332326-16332348 AAGCCTAGAAGGAACTCAGCAGG - Intergenic
1163627005 19:18396087-18396109 CAGCCTTCAAGCGGCAGAGCTGG + Intronic
1163741799 19:19018846-19018868 CATCCTTAAAACAGCCCAGCAGG + Intronic
1164170065 19:22717144-22717166 CTGCCTGGAATCTGCTCAGCGGG - Intergenic
1164591402 19:29509569-29509591 CAGCACTGAGGCACCTCAGCAGG + Intergenic
1165181440 19:33974956-33974978 GACCCTAGAAGCAGCTTAGCTGG + Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166318388 19:42001727-42001749 GAGCCTCGGAGCAGCTTAGCTGG - Intronic
1167619956 19:50555261-50555283 CAGCCCTCCAGCAGCACAGCCGG + Intronic
1168099216 19:54132199-54132221 CAGGCATGAACCAGCACAGCTGG + Intergenic
1168381873 19:55931003-55931025 CAGCCCTGTAACACCTCAGCAGG + Intronic
925768955 2:7263955-7263977 CAGCCTTGAGGCACCTGATCTGG + Intergenic
926337068 2:11871732-11871754 CAGCCCTGATGCAGCTGATCAGG + Intergenic
926572175 2:14541796-14541818 CCTCCTTGAAGCAGATCAGCTGG + Intergenic
931834136 2:66081399-66081421 CAGCCTTGAAACGTCTCACCTGG - Intergenic
932658473 2:73630909-73630931 CAGCATTGAAGCGGCTCTGAGGG + Intergenic
932665084 2:73690916-73690938 CAGCATTGAAGCGGCTCTGAGGG + Intergenic
936251299 2:110870167-110870189 AACCCTTGAAGCACCTCAGGTGG - Intronic
936374173 2:111926771-111926793 CACCCTTGAGGGAGCTCTGCAGG + Intronic
937346617 2:121130045-121130067 CAGCCATCAAGCAGATGAGCTGG + Intergenic
942162488 2:173206277-173206299 CAGTCTTGAAGCTGTGCAGCTGG + Intronic
944821473 2:203436690-203436712 CAGACTTGAAGCAGCCAAGCTGG + Exonic
946637350 2:221744242-221744264 CAATCTGGGAGCAGCTCAGCTGG + Intergenic
946803210 2:223443011-223443033 CAGACTGGAAGCAGAACAGCAGG + Intergenic
947866893 2:233404389-233404411 CAGCATGGAAGCTGCTCTGCAGG - Intronic
948537541 2:238657524-238657546 CAGGCTTCAGCCAGCTCAGCTGG + Intergenic
1169419167 20:5445517-5445539 TAGCTCAGAAGCAGCTCAGCTGG + Intergenic
1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1172526877 20:35605131-35605153 GCGCCTTGAAGGAGCACAGCTGG - Intergenic
1172633436 20:36393870-36393892 CAGCCCTGAGGCAGCTGAGGAGG + Intronic
1173584756 20:44174228-44174250 CAGCCCAGGAGTAGCTCAGCTGG + Intronic
1175630054 20:60528172-60528194 CAGCCTTGTAGCAGTTCTGAAGG - Intergenic
1175806513 20:61832093-61832115 CAGCCTTGAAGCAGCTGCCATGG - Intronic
1175871290 20:62210662-62210684 CTGCCTGGCTGCAGCTCAGCAGG - Intergenic
1175874898 20:62224701-62224723 CATCCTTGCAGCAGCTCAAGGGG - Intergenic
1175970800 20:62685817-62685839 AAGCCGGGAAGCAGCTCTGCAGG - Intergenic
1178057475 21:28815420-28815442 CAGCCTTGAAGATGCTAAGCTGG + Intergenic
1179405627 21:41123081-41123103 CTGCCCTGAAGCATGTCAGCTGG + Intergenic
1182289397 22:29266725-29266747 CTGCCCTGAATCAGCTCAGTGGG - Intronic
1182394985 22:30028755-30028777 CACACTAGAACCAGCTCAGCTGG - Intronic
1182755497 22:32675705-32675727 CAGCCTTCATGCAGCTTAGCTGG - Intronic
1183489261 22:38108080-38108102 CAGCCTGGGAGCAGCCCGGCAGG + Intronic
1184167613 22:42739576-42739598 AACCCTTGAAGCAGGTGAGCTGG + Intergenic
1184648119 22:45907083-45907105 AGGCCTTGGAGCAGGTCAGCAGG + Intergenic
1184835196 22:47016838-47016860 CAGCCACGCAGCAGCTCTGCAGG - Intronic
950479871 3:13237601-13237623 CAGCCTTGGAGCAGCTTTACTGG - Intergenic
951644077 3:24867676-24867698 CAGTGTTGAAGCAACTCAGAAGG + Intergenic
960704496 3:120468989-120469011 CAGCCTGGCTTCAGCTCAGCAGG + Intergenic
960705594 3:120477822-120477844 CAGCCTGGCTTCAGCTCAGCAGG - Intergenic
963212376 3:142707532-142707554 CAGCTTTTAAGCAGAACAGCTGG + Intronic
966386467 3:179404429-179404451 CAGGCTTGAATCACCTCACCTGG - Intronic
968733978 4:2285779-2285801 CATCCCAGAAACAGCTCAGCGGG + Intronic
969469957 4:7381883-7381905 CAGCCTTCAACCAGCAGAGCAGG + Intronic
970728191 4:19072080-19072102 TAGCCTTGAACCAGGGCAGCTGG - Intergenic
972991887 4:44830682-44830704 GAGCCATGACACAGCTCAGCTGG + Intergenic
975619329 4:76280368-76280390 GAGCCATGAAGCCCCTCAGCAGG - Intronic
976347774 4:84025155-84025177 CAGCCTTTGATCATCTCAGCTGG - Intergenic
976616158 4:87079640-87079662 AAGCTCTGAAGCAGCTGAGCTGG - Intronic
979846936 4:125525313-125525335 CAGCCTTGGAGCCCATCAGCAGG - Intergenic
980102927 4:128559716-128559738 CAGCCTTGAATCAACTGAGGAGG - Intergenic
982822634 4:159962406-159962428 CACCCTTGAAGAAAATCAGCTGG + Intergenic
985512016 5:318404-318426 CACCCTGGAAGCAGCTCTGACGG + Intronic
986974773 5:13382023-13382045 CTGGCTTGAAGCAGCTGAGGTGG - Intergenic
991641395 5:68757934-68757956 GAGCCATGAAGCAGCCTAGCTGG + Intergenic
994434058 5:99706246-99706268 CAGCCTGTTAGCAGCTCAGTTGG - Intergenic
998930629 5:147177242-147177264 CAGCCAGGATGGAGCTCAGCTGG + Intergenic
1000134844 5:158337262-158337284 CAACCTTGAAGGAGCCCAGAGGG - Intergenic
1001071464 5:168588753-168588775 TAGCCTTCAAACAGCTCATCTGG - Intergenic
1001254034 5:170170201-170170223 CATCCATGAATCAGCTCAGATGG - Intergenic
1001892320 5:175349932-175349954 CAACCTTCAAGCTGCTTAGCTGG - Intergenic
1002047996 5:176552829-176552851 CAGCCTTGGAGCTGCTGGGCAGG + Intronic
1002187209 5:177459918-177459940 CAGCCTGGGAGCAGTACAGCAGG + Intronic
1006577147 6:35054916-35054938 CAGGCTGAAAGCAGCCCAGCTGG + Intronic
1007109814 6:39306706-39306728 CAGCCTGCAAGGAGCTGAGCTGG - Intronic
1007278640 6:40693795-40693817 CTGCCCTGAACCAGCTCAGTGGG - Intergenic
1009938911 6:70267139-70267161 CAGCCTTGACCAAGCTCAGCTGG + Intronic
1010406248 6:75509235-75509257 AAGCCATGAAGAAGCACAGCTGG - Intergenic
1014169881 6:118267045-118267067 CAGCCTTGTACCGGATCAGCAGG - Exonic
1015244020 6:131057575-131057597 CAGCCCTGAAGCTCATCAGCAGG + Intronic
1015365387 6:132392039-132392061 CAACCCTGACACAGCTCAGCTGG - Intronic
1016390899 6:143573986-143574008 GAGCCTGCGAGCAGCTCAGCTGG + Intronic
1016607040 6:145941643-145941665 CTGCCTTGATGAAGCTCAGATGG - Exonic
1017308910 6:152954041-152954063 CAGCCCTGTAGTAGCTCAGTTGG - Intergenic
1018926475 6:168210623-168210645 CAGCATGAAGGCAGCTCAGCGGG - Intergenic
1019073205 6:169366679-169366701 CAGCCTACAAACAGCCCAGCAGG + Intergenic
1019647652 7:2139617-2139639 CAGCCTTGAAGGAGAGCGGCGGG - Intronic
1023245646 7:38200327-38200349 CAGCCTTGAAGCGACACAGCAGG - Intronic
1025028181 7:55535134-55535156 CAGCCTTGACAAAGCTCAGGGGG + Intronic
1032985361 7:137331253-137331275 CAGATTAGAAGCAGTTCAGCAGG - Intronic
1034897164 7:154885027-154885049 CAGCCTTGAAGGCACTGAGCAGG + Intronic
1036226910 8:6967053-6967075 CAGCCATGCAGCATCTCAGTGGG + Intergenic
1040780763 8:51106824-51106846 AAGCCTTCAATCAGCTCAGTAGG + Intergenic
1041868734 8:62608484-62608506 CAGCTCTGAAGTGGCTCAGCAGG + Intronic
1043424462 8:80134828-80134850 GAGTCTTGGAGCAGCTCATCTGG - Intronic
1045238985 8:100381643-100381665 CAGGCTTGATGCAGGGCAGCAGG + Intronic
1047760668 8:127951716-127951738 CATCCAGGAAGCAGCTGAGCTGG + Intergenic
1048905390 8:139082832-139082854 CAGCCATGAAGAAAATCAGCTGG - Intergenic
1049381362 8:142318001-142318023 CAGCCCTGGGGCAGCTGAGCCGG + Intronic
1049754917 8:144306638-144306660 CAGGCGTGAACCAGCGCAGCCGG + Intronic
1050017786 9:1253595-1253617 ATGCCTTGCAGCAGCTGAGCTGG + Intergenic
1053274487 9:36772914-36772936 CAGCTTTGAAGTAGCTCTGGCGG - Intergenic
1053792046 9:41693593-41693615 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054153110 9:61621172-61621194 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054180451 9:61905613-61905635 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054472904 9:65552376-65552398 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1056934626 9:90906585-90906607 CAGCCCCCACGCAGCTCAGCTGG + Intergenic
1057079042 9:92158658-92158680 CAACCTCGAAGAAGCTGAGCAGG - Intergenic
1057544460 9:96007192-96007214 CAGTCATCAAGCAGCTGAGCTGG + Intronic
1057909335 9:99005553-99005575 CAGGTTTGAATCAGCTGAGCTGG - Intronic
1058189294 9:101893122-101893144 CAGCCTTGATGAATCTGAGCTGG - Intergenic
1060779978 9:126404442-126404464 CAGCCGTGAAGCCTCTCATCAGG + Intronic
1061395436 9:130341205-130341227 CATCCTTGGACCAGCTCAGCTGG - Intronic
1185787584 X:2903879-2903901 CAGCTTTGAAGGAACTCACCTGG - Intergenic
1186493459 X:9993064-9993086 GAGCCCTGAATCAACTCAGCGGG - Intergenic
1188012994 X:25077069-25077091 CAGCATTGCAGCAGCTCCGTGGG + Intergenic
1194872698 X:99152940-99152962 CAGCCTGCATGCAGCTCAGAGGG + Intergenic