ID: 1078463765

View in Genome Browser
Species Human (GRCh38)
Location 11:11535187-11535209
Sequence GCTGCTGGTGAGGCAGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 1563}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078463762_1078463765 25 Left 1078463762 11:11535139-11535161 CCACAGTGCAGTGCTTTTTACAT 0: 1
1: 0
2: 1
3: 24
4: 250
Right 1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG 0: 1
1: 0
2: 3
3: 51
4: 1563
1078463761_1078463765 26 Left 1078463761 11:11535138-11535160 CCCACAGTGCAGTGCTTTTTACA 0: 1
1: 0
2: 1
3: 19
4: 172
Right 1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG 0: 1
1: 0
2: 3
3: 51
4: 1563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078463765 Original CRISPR GCTGCTGGTGAGGCAGACCC TGG Intronic
900005983 1:51752-51774 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
900119479 1:1042341-1042363 GGGGCTGGTGAGGCAGAGGCGGG + Intronic
900142828 1:1145679-1145701 GCTGCAGGTCCGGCAGAGCCAGG + Intergenic
900174713 1:1286594-1286616 GCTGCCGGTGAGGTCGGCCCCGG - Intronic
900176014 1:1291685-1291707 GCTGCTGGTCTGGCCCACCCTGG - Exonic
900406230 1:2494242-2494264 GCAGCTCGTGAGGCAGCCCTGGG + Intronic
900868993 1:5288595-5288617 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
901032006 1:6312577-6312599 GCTGCTTGGGAGGCAGAGGCAGG - Intronic
901276524 1:7995904-7995926 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
901364233 1:8731912-8731934 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
901440391 1:9274422-9274444 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
901473735 1:9474978-9475000 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
901482544 1:9535484-9535506 GCTACTCGTGAGGCAGAGGCAGG + Intergenic
901703014 1:11055524-11055546 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
901889211 1:12247813-12247835 GCTACTCGTGAGGCTGAGCCAGG - Intronic
901977890 1:13009934-13009956 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
902004196 1:13219003-13219025 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
902023418 1:13364744-13364766 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
902112290 1:14092200-14092222 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
902223620 1:14982539-14982561 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
902335960 1:15754876-15754898 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
902376399 1:16032069-16032091 GGTGCTTGTAAGGCAGTCCCTGG + Intronic
902381368 1:16053998-16054020 GGTGCTTGTAAGGCAGTCCCTGG + Intronic
902474437 1:16673795-16673817 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
902484366 1:16733647-16733669 GCTACTGGGGAGGCAGAGGCAGG - Intergenic
902820816 1:18942158-18942180 GGTGTTGGTGAGCCTGACCCAGG + Intronic
902846934 1:19118530-19118552 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
902938095 1:19779280-19779302 GTTGCGGGTGAGGCAGAGGCAGG - Intronic
902941011 1:19800054-19800076 GCAGCTGGCGAGTCAGAGCCTGG - Intergenic
903223214 1:21880490-21880512 GCTGCAGGTGCTGCAGAGCCTGG - Exonic
903260409 1:22128829-22128851 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
903336053 1:22625562-22625584 GCTGCTGCAGAGGCAGACATAGG - Intergenic
903523536 1:23974101-23974123 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
903743347 1:25571144-25571166 GCTGCTGGCGAGGCAGAGCAGGG - Intergenic
903898268 1:26623091-26623113 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
903988013 1:27243322-27243344 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
904185122 1:28698026-28698048 GCTGCTGGGGAGGCTGAGACAGG + Intronic
904519865 1:31086533-31086555 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
904729460 1:32578013-32578035 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
904949194 1:34222713-34222735 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
905137772 1:35813295-35813317 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
905158498 1:36010048-36010070 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
905199540 1:36306749-36306771 GGTGCAGGTGAGGCCGAGCCAGG + Exonic
905337376 1:37254757-37254779 GCTACTGGAGAGGCAGAGCTAGG + Intergenic
905816279 1:40953490-40953512 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
906277570 1:44528410-44528432 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
906330589 1:44880847-44880869 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
906379790 1:45325515-45325537 GTTGCTGGTGATTCAAACCCAGG + Intergenic
906402671 1:45516907-45516929 GCTACTGGGGAGGCTGAGCCAGG + Intronic
906416738 1:45625702-45625724 GCTGCTGGTGGGTCATACCTTGG - Intergenic
906482954 1:46212390-46212412 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
906499468 1:46331040-46331062 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
906565626 1:46799177-46799199 GCTGCTGCGGAGGCAGACGTTGG + Exonic
906688609 1:47778354-47778376 GCTTCTGGTGAGGCAGAGGCAGG - Intronic
907122317 1:52018286-52018308 GCTGCTTGGGAGGCAGAGGCAGG + Intergenic
907259396 1:53206069-53206091 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
907386576 1:54129439-54129461 GCTGCAGGTCAGGCAGACTTGGG - Intergenic
907407921 1:54265139-54265161 GCTGTGGGTGAGGCAGACCATGG - Intronic
907436515 1:54452783-54452805 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
908123448 1:61007214-61007236 GCTACTGGGGAGGCTGAGCCAGG - Intronic
908245100 1:62221788-62221810 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
909017325 1:70393939-70393961 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
909561242 1:77011129-77011151 GCTTCTGTTGTGGCAGACCTTGG - Intronic
909908922 1:81235941-81235963 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
910405341 1:86883012-86883034 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
910537820 1:88319501-88319523 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
910734790 1:90441691-90441713 GCTACTGGTGAGGCTGAAGCAGG + Intergenic
910779506 1:90913669-90913691 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
910876396 1:91882631-91882653 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
910880789 1:91920703-91920725 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
910907396 1:92195253-92195275 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
910907904 1:92201020-92201042 GCTGCTTGTGAGGCTGAGGCAGG - Intergenic
910981384 1:92962079-92962101 GCAGCTGGAGACGCAGACCGGGG + Intergenic
911179192 1:94846033-94846055 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
912371938 1:109180393-109180415 GCTACTGGGGAGGCTGACGCAGG + Intronic
912404134 1:109422582-109422604 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
912920937 1:113866397-113866419 GCTACTGGGGAGGCTGAGCCAGG + Intronic
913117077 1:115707126-115707148 GCTACTTGTGAGGCTGACACAGG - Intronic
913145642 1:115987275-115987297 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
913656771 1:120968175-120968197 ACTGCTGGGGAGGCTGACCTAGG - Intergenic
914087755 1:144469031-144469053 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914098668 1:144565567-144565589 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
914201334 1:145488000-145488022 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
914300316 1:146372073-146372095 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
914310856 1:146465173-146465195 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914314317 1:146495536-146495558 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914422021 1:147538023-147538045 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
914480455 1:148061111-148061133 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
914500031 1:148237845-148237867 GCTGCTGGTTGGGCAGAGCTAGG + Intergenic
914518358 1:148393363-148393385 GCTGCTGGGGAGGCTGACGCAGG + Intergenic
914521330 1:148419422-148419444 ACTGCTGGGGAGGCTGACCTAGG - Intergenic
914591248 1:149107973-149107995 GCTGCTGGTTGGGCAGAGCTAGG - Intergenic
914646739 1:149659912-149659934 ACTGCTGGGGAGGCTGACCTAGG - Intergenic
914723635 1:150309411-150309433 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
914733143 1:150390385-150390407 GCTGCTCGGGAGGCAGAGGCAGG + Intronic
914816859 1:151069770-151069792 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
914892903 1:151643404-151643426 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
915100108 1:153493147-153493169 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
915160233 1:153914129-153914151 GCTACTGGGGAGGCTGACACAGG + Intronic
915256419 1:154634166-154634188 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
915315491 1:155026418-155026440 CCTGCTGGTGAGGCTGACTGTGG - Intronic
915381650 1:155446731-155446753 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
915418957 1:155764549-155764571 GCTGCTTGGGAGGCAGAGGCAGG - Intronic
915593188 1:156882040-156882062 CCTGCTGGTAAGGCAGCCTCTGG + Intergenic
915728701 1:158037379-158037401 GCTGCTCGGGAGGCTGACGCAGG + Intronic
916092378 1:161317671-161317693 GCTGCTTGGGAGGCTGAGCCAGG - Intronic
916095407 1:161345566-161345588 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
916172460 1:162011134-162011156 ACTGCAGGTGAGGCAAACCCTGG + Intronic
916232003 1:162549889-162549911 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
916468397 1:165095064-165095086 GCTGCAGCTGAGGCAAACCTAGG + Intergenic
916615392 1:166434047-166434069 GCTGCTGCTGATGCAGAGTCAGG - Intergenic
916882081 1:169028737-169028759 GCTGCTTGGGAGGCAGAAGCAGG + Intergenic
917038890 1:170780324-170780346 GCTGCTGGGGAGGCTGAGGCTGG + Intergenic
917325390 1:173826110-173826132 GCTGCTGGGGAGGCCGAGGCAGG + Intronic
917336275 1:173927212-173927234 GCTACTGGGGAGGCTGACACAGG - Intergenic
917531290 1:175837621-175837643 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
917854153 1:179087913-179087935 GCAGCTGATGAGCCAGATCCGGG + Exonic
917872799 1:179256884-179256906 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
917937245 1:179880999-179881021 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
918235070 1:182572332-182572354 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
918451229 1:184661160-184661182 CCTGCAACTGAGGCAGACCCTGG - Intergenic
918692242 1:187496188-187496210 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
919295772 1:195698238-195698260 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
919329235 1:196148043-196148065 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
919350900 1:196452761-196452783 GCTGATGGTGTGAGAGACCCAGG + Intronic
919364658 1:196642259-196642281 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
919875652 1:201865318-201865340 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
919896325 1:202011763-202011785 GCTACTGGGGAGGCTGACGCAGG + Intronic
919900420 1:202040221-202040243 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
920138291 1:203788503-203788525 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
920161552 1:204002304-204002326 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
920165063 1:204029952-204029974 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
920165819 1:204035194-204035216 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
920691409 1:208149639-208149661 GGTGCTGCTGAGGCTGACCCTGG + Intronic
920712229 1:208306258-208306280 ACAGCTGGTGATGCGGACCCAGG + Intergenic
920782230 1:209005030-209005052 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
920822246 1:209392041-209392063 ACTCCTGGTGACTCAGACCCTGG + Intergenic
921220349 1:212969302-212969324 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
921269053 1:213450861-213450883 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
921365520 1:214370166-214370188 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
921927471 1:220723341-220723363 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
922312979 1:224413919-224413941 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
922313023 1:224414215-224414237 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
922455187 1:225768574-225768596 GCTGTTGGTGACCCATACCCAGG + Intergenic
922726032 1:227923498-227923520 GCTGTTGGGGTGGCTGACCCGGG - Intronic
922859921 1:228807744-228807766 GCTTCTGGTGAGGCAGCTGCTGG - Intergenic
922958109 1:229622715-229622737 GCTGCTGAGGAGGCTGACTCAGG - Intronic
922999672 1:229996681-229996703 TCTGCTGGTAAGGAAGACCTTGG - Intergenic
923178217 1:231489947-231489969 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
923506395 1:234609596-234609618 GCCGCTGGTGGGGGAGACGCGGG - Intergenic
923651322 1:235876873-235876895 GGTCCTGGTGGGGCAGCCCCAGG + Intronic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
923708800 1:236368550-236368572 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
923775938 1:236978427-236978449 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
923854139 1:237827823-237827845 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
924752583 1:246908781-246908803 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
924758984 1:246967048-246967070 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
924855974 1:247875414-247875436 GCTGCTGGGGAGGCAGACACGGG + Intronic
1062882626 10:990609-990631 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1062930384 10:1348767-1348789 GCTGCTGCTGAGGCCAACGCTGG + Intronic
1063059713 10:2538476-2538498 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1063319275 10:5037451-5037473 TCTCCTGGGGAGGCAGACCACGG - Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064026810 10:11855360-11855382 GCTACTGGGGAGGCTGAGCCAGG + Intronic
1064177331 10:13086556-13086578 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1064205755 10:13322251-13322273 GCTGCTTGGGAGGCTGAGCCAGG - Intronic
1064282841 10:13967223-13967245 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1064307572 10:14181800-14181822 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1064451447 10:15445637-15445659 GCTGCTTGGGAGGCAGAGGCAGG - Intergenic
1064606633 10:17048587-17048609 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1064683178 10:17832441-17832463 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1064906616 10:20353469-20353491 GCTGCTTGTGAGGCTGAGGCAGG + Intergenic
1064930345 10:20618994-20619016 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1065007790 10:21395693-21395715 GCTGCTGGGGAGGCTGAGGCGGG - Intergenic
1065435655 10:25701819-25701841 GCTGCTCGGGCGGGAGACCCCGG - Intergenic
1065472241 10:26094534-26094556 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1065703312 10:28446260-28446282 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1065801849 10:29359456-29359478 GCTACTGGGGAGGCTGACTCAGG - Intergenic
1066232864 10:33454710-33454732 GCTGCTAATGAGGCTGACCTTGG - Intergenic
1066351733 10:34642441-34642463 CAGGCTGGTGAGGCAGAGCCAGG - Intronic
1066371316 10:34820453-34820475 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1066419403 10:35250080-35250102 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1066472851 10:35716238-35716260 GCTGCTCGTGAGGCTGAGGCAGG + Intergenic
1066529712 10:36323893-36323915 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1066635419 10:37494752-37494774 GCTACTCGGGAGGCTGACCCAGG - Intergenic
1067040065 10:42945942-42945964 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1067251425 10:44589998-44590020 GCCGGTGTTGAGGCAGTCCCAGG + Intergenic
1067738996 10:48880858-48880880 GCTTCTGGAGATGCAGGCCCGGG + Intronic
1067961014 10:50849903-50849925 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1067992951 10:51236612-51236634 GCTGCTCGGGAGGCTGAGCCAGG - Intronic
1068532725 10:58208050-58208072 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1069028109 10:63565994-63566016 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1069133191 10:64731642-64731664 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1069138937 10:64799955-64799977 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1069386519 10:67887686-67887708 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1069458882 10:68575906-68575928 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1069605329 10:69735402-69735424 GCTGCTGGAGAGGAAGCCCGGGG - Intergenic
1069955090 10:72044988-72045010 GCTGTGGGTGAGGCAGGACCGGG + Intergenic
1069966596 10:72123225-72123247 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1069989316 10:72304810-72304832 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1070096841 10:73345691-73345713 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1070224759 10:74491352-74491374 GCTGCTTGAGAGGCTGACGCAGG - Intronic
1070225274 10:74497717-74497739 GCTGCTTGGGAGGCAGAGACAGG + Intronic
1070249731 10:74763582-74763604 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1070260221 10:74847550-74847572 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1070320164 10:75348621-75348643 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1070946183 10:80393741-80393763 GCTACTGGAGAGGCTGAGCCAGG + Intergenic
1071052830 10:81472901-81472923 GCTGCAGGGGAGGCAGGACCCGG + Intergenic
1071178554 10:82956103-82956125 GCTCCTGGGAAGGCAGACCCTGG - Intronic
1071397344 10:85237309-85237331 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1071551282 10:86568117-86568139 GCTGCTTGGGAGGCTGACGCAGG + Intergenic
1071681174 10:87707105-87707127 CCTGCTAGTGAGACAGAGCCAGG - Intronic
1071829058 10:89353827-89353849 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1072127376 10:92458876-92458898 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1072598055 10:96894201-96894223 GCTGCTCGGGAGGCTGACACAGG - Intronic
1072609636 10:97008989-97009011 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1072866932 10:99072815-99072837 GCTACTTGTGAGGCAGAGGCAGG + Intronic
1073252559 10:102130303-102130325 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073333903 10:102690393-102690415 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1073357913 10:102871433-102871455 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1073638969 10:105230203-105230225 GCTTCAGGGGAGGCAGAGCCAGG + Intronic
1073876477 10:107928126-107928148 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1074084530 10:110198049-110198071 GCTACTGGTGAGGCCGAGGCAGG + Intergenic
1074309502 10:112309923-112309945 GCTACTGGGGAGGCTGAACCCGG + Intergenic
1074387814 10:113030941-113030963 GGAGCTGGTGAGACAGACTCTGG - Intronic
1074756426 10:116627488-116627510 GCTGGGGGTGGGGCAGTCCCGGG + Intronic
1075087290 10:119422143-119422165 CCAGCTGGTGAGTCAGCCCCTGG + Intronic
1075319950 10:121483428-121483450 GCTGCTGGTGGAGCAGTCCGGGG - Intronic
1075764301 10:124880291-124880313 GCTGCTGGGGAGGCTGAGGCGGG + Intergenic
1075781296 10:125018851-125018873 CCTTCTGGTGAAGCACACCCAGG + Intronic
1075950918 10:126477019-126477041 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1075958774 10:126548476-126548498 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1076149129 10:128149114-128149136 GCTACTGGGGAGGCAGAGGCAGG - Intergenic
1076236172 10:128865084-128865106 CCTGCAGCTGAGGCAAACCCTGG - Intergenic
1076380817 10:130023551-130023573 GCAGATGGTGAGGCACACCAGGG - Intergenic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1076743969 10:132503651-132503673 GCTGCTGGAGAGGCCGCCCTTGG - Intergenic
1076754799 10:132563777-132563799 CTTGCTGGTGAGACAGCCCCGGG + Intronic
1077028174 11:450846-450868 GCTGTAGGTGGGGGAGACCCTGG + Intronic
1077225238 11:1436659-1436681 GCTGCTGGGAAGCCTGACCCTGG + Intronic
1077225290 11:1436827-1436849 GCTGCGGGTGGGGCAGGACCCGG + Intronic
1077361222 11:2140941-2140963 GCTGAAGGTGAGCGAGACCCCGG + Exonic
1077487170 11:2844340-2844362 GCTGCTGGTGACAGAGGCCCCGG - Intronic
1077605286 11:3606433-3606455 GCTGCTGGGGAGGCTGATGCAGG - Intergenic
1077869141 11:6246930-6246952 GCTACTGGGGAGGCTGACTCAGG + Intergenic
1078163873 11:8866069-8866091 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1078379915 11:10830592-10830614 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1078443310 11:11385405-11385427 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1078768914 11:14328774-14328796 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1079013281 11:16847206-16847228 GCTGCTCGTGAGGCTGAGGCAGG - Intronic
1079219755 11:18549931-18549953 GCTACTTGGGAGGCAGACGCAGG - Intronic
1079241467 11:18725237-18725259 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1079359581 11:19759192-19759214 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1079536558 11:21522120-21522142 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1079788918 11:24711336-24711358 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1079948054 11:26767796-26767818 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1080393106 11:31866096-31866118 GAGGCTGATGAGCCAGACCCGGG - Intronic
1080594415 11:33757570-33757592 GCTACTTGGGAGGCAGACGCAGG + Intronic
1080675118 11:34418923-34418945 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1080770176 11:35333303-35333325 GCTACTGGGGAGGCTGACGCAGG + Intronic
1080832075 11:35903895-35903917 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1081387189 11:42485675-42485697 GCTACTGGGGAGGCAGAGGCAGG - Intergenic
1081447324 11:43143336-43143358 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1081544623 11:44061581-44061603 GCTGCTTGGGAGGCAGAGGCAGG - Intergenic
1081796121 11:45821145-45821167 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1081813806 11:45927754-45927776 GCTGCTGTTGAAGCCGGCCCTGG - Intronic
1081872203 11:46388367-46388389 GCTGCTGGGGAGGATGTCCCAGG - Intergenic
1081973915 11:47219054-47219076 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1082055696 11:47813957-47813979 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1082064848 11:47891750-47891772 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082282718 11:50287288-50287310 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1082669897 11:56022587-56022609 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1082697444 11:56386873-56386895 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1082816565 11:57513723-57513745 CCTGCTGGTCATCCAGACCCTGG - Intronic
1083574294 11:63778263-63778285 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1083599909 11:63940160-63940182 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1083723171 11:64613645-64613667 CCTGCTGATCAGGCATACCCAGG + Intronic
1084019151 11:66407367-66407389 GCTACTTGGGAGGCTGACCCAGG + Intergenic
1084034075 11:66497401-66497423 GCTGCGGTCGAGGCGGACCCGGG - Exonic
1084071580 11:66739918-66739940 GCTGCTCGTGAGGCTGAGGCAGG + Intergenic
1084075313 11:66770590-66770612 GCTACTTGGGAGGCTGACCCAGG + Intronic
1084124502 11:67090061-67090083 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084460504 11:69294246-69294268 GCTTCAGGTGAGGGAGACCCTGG - Exonic
1084664794 11:70570577-70570599 GCAGCTGTGGAGGCAGACCCGGG - Intronic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085125008 11:73994152-73994174 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1085512295 11:77094510-77094532 GCTGGAGTGGAGGCAGACCCTGG + Intronic
1085552576 11:77388463-77388485 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1086108572 11:83173840-83173862 GCTACTGGGGAGGCTGAGCCCGG - Intronic
1086379445 11:86236856-86236878 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1086452472 11:86930676-86930698 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1087738945 11:101865802-101865824 GCTACTGGTGAGGCTGAAGCAGG + Intronic
1087763979 11:102129918-102129940 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1087767490 11:102172079-102172101 GCTGCTTGGGAGGCTGACACAGG + Intronic
1087847371 11:102989076-102989098 GCTGCTGGGGAGGCTGAGGCGGG - Intergenic
1088251511 11:107865098-107865120 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1088353919 11:108921844-108921866 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1088380276 11:109185152-109185174 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1088401290 11:109424020-109424042 CCGGCTGGAGAGGCAGCCCCGGG + Exonic
1088642788 11:111889570-111889592 GCTACTGGGGAGGCAGAGGCAGG - Intergenic
1089707463 11:120290078-120290100 GCTGCTGTTGAAACAGACCTCGG + Intronic
1089714572 11:120345589-120345611 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1089714956 11:120350401-120350423 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1089793755 11:120963735-120963757 GCTGGGAGTCAGGCAGACCCCGG + Intronic
1089977385 11:122744040-122744062 CCTGCCTGTGAGGGAGACCCAGG + Intronic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090038204 11:123267080-123267102 GCTGCTTGGGAGGCTGACGCAGG - Intergenic
1090091722 11:123703927-123703949 GCTGCTGGTGTGGCATTCCCCGG - Intergenic
1090173804 11:124629225-124629247 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1090712388 11:129399471-129399493 GCTGCTGGAGAGGCTGAGACAGG - Intronic
1090922853 11:131222018-131222040 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1091096509 11:132827749-132827771 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1091171026 11:133519901-133519923 GCTGCATGTGAGACAGACCTGGG + Intronic
1091271774 11:134319064-134319086 GCTGCTGGGGAGGCTGAGGCAGG - Exonic
1091292699 11:134450981-134451003 GCTGCTCGGGAGGCAGAGGCAGG - Intergenic
1091375469 12:22256-22278 GCTGCTGGGGAGGAAGAAGCAGG + Intergenic
1091405759 12:208273-208295 TCTGGTGCTGAGGCTGACCCTGG - Intronic
1091546512 12:1504706-1504728 GGTGCAGGTGAGGCAGGCACGGG - Intergenic
1091734099 12:2904971-2904993 GCTGCTTGGGAGGCTGACGCAGG + Intronic
1091798675 12:3311167-3311189 GCTCCTGGTGTGACAGCCCCAGG + Intergenic
1092030521 12:5279814-5279836 GATGCTGGTGAGGTAGACCGTGG + Intergenic
1092132430 12:6121817-6121839 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1092354063 12:7779861-7779883 GCTGCTCGGGAGGCTGAGCCAGG + Intergenic
1092382683 12:8010688-8010710 GCTGCTTGTGAGGCTGAGGCAGG - Intergenic
1092734444 12:11567197-11567219 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1092874288 12:12834549-12834571 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1093107808 12:15110588-15110610 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1093111641 12:15159710-15159732 GCTGCTTGTGAGGCTGAGGCAGG + Intronic
1093139811 12:15496252-15496274 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1093246476 12:16743929-16743951 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1093302872 12:17476748-17476770 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1093644165 12:21564317-21564339 GCTACTGGGGAGGCTGAGCCAGG + Intronic
1093900665 12:24627710-24627732 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1094156254 12:27339734-27339756 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1094552447 12:31465477-31465499 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1094607987 12:31965777-31965799 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1095091981 12:38116097-38116119 GCTACTTGTGAGGCTGAACCAGG + Intergenic
1095183996 12:39179893-39179915 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1095347402 12:41167916-41167938 GCTGCTGGGGAGGCAGGCCCGGG - Intergenic
1095807476 12:46335742-46335764 GCTGCTTGGGAGGCTGACACTGG + Intergenic
1095822619 12:46495408-46495430 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1096064845 12:48731377-48731399 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1096074395 12:48793494-48793516 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1096247647 12:50001951-50001973 GCTGCTTGGGAGGCCGACGCAGG + Intronic
1096311692 12:50526745-50526767 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1096373117 12:51084690-51084712 GCTCCTCGGGAGGCCGACCCAGG + Intergenic
1096481673 12:51945941-51945963 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1096727357 12:53575293-53575315 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1096856886 12:54489620-54489642 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1096983297 12:55741518-55741540 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1097065792 12:56319583-56319605 GATGCAAGTGAGGCACACCCTGG - Intronic
1097100458 12:56584671-56584693 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1097105456 12:56620669-56620691 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1097214099 12:57396327-57396349 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1097430974 12:59506580-59506602 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1097645028 12:62226303-62226325 GCTACTGGGGAGGCAGAGGCGGG - Intronic
1097678172 12:62624772-62624794 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1097797581 12:63880341-63880363 GCTGCTGGGGAGGCTGAGTCAGG - Intronic
1098064100 12:66593954-66593976 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1098343675 12:69477392-69477414 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1098352657 12:69580619-69580641 GCTACTTGGGAGGCAGAGCCAGG - Intergenic
1099688414 12:85919762-85919784 GCTGCTCGGGAGGCTGACGCAGG - Intergenic
1099742990 12:86665486-86665508 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1100015247 12:90002246-90002268 GCTGCTGCTCAGGCAGTCCCAGG - Intergenic
1100075968 12:90784335-90784357 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1100107271 12:91191134-91191156 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1100131456 12:91499080-91499102 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1100151387 12:91742188-91742210 GGTGCTGGAGAGGGTGACCCAGG + Intergenic
1100251901 12:92834990-92835012 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1100262043 12:92941615-92941637 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1100728937 12:97441982-97442004 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1101142951 12:101814583-101814605 GCTACTCGTGAGGCTGAGCCAGG + Intronic
1101854414 12:108430162-108430184 GGTGCAGGTGAGGCTGGCCCAGG - Intergenic
1102051175 12:109862938-109862960 GCTACTGGGGAGGCTGAGCCAGG + Intronic
1102052579 12:109873520-109873542 GCTACTGGGGAGGCTGAGCCAGG + Intronic
1102370481 12:112378928-112378950 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1102501468 12:113355918-113355940 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1102874416 12:116438704-116438726 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1102959569 12:117083980-117084002 GCTTCTGGGGAGGCTGACGCAGG + Intronic
1102989420 12:117304058-117304080 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1103072309 12:117954903-117954925 GCTACTGGGGAGGCTGACACAGG + Intronic
1103502606 12:121414982-121415004 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1103814676 12:123644552-123644574 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1104032575 12:125075703-125075725 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1104053786 12:125214231-125214253 GCTTCTGATGTGGCTGACCCAGG + Intronic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1104836444 12:131795204-131795226 GCTGCTGGAGGGGCTGTCCCTGG - Intronic
1105009296 12:132744790-132744812 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1105325340 13:19365414-19365436 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1105367173 13:19775937-19775959 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1105398151 13:20060564-20060586 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1105670616 13:22610752-22610774 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1105675275 13:22664591-22664613 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1105686220 13:22784766-22784788 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1105723839 13:23141946-23141968 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1105888722 13:24666157-24666179 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1106287205 13:28328458-28328480 GCGGCTGGTGAAGCAGCTCCGGG - Intronic
1106359888 13:29021153-29021175 GCTGCTTGGGAGGCTGACCCAGG + Intronic
1106451796 13:29888935-29888957 GCTGCTGGTGACCCTGGCCCTGG + Intergenic
1106811296 13:33360905-33360927 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1106834791 13:33622525-33622547 GCTACTAGGGAGGCAGACGCAGG + Intergenic
1107473842 13:40715956-40715978 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1107497034 13:40936647-40936669 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1107925232 13:45253959-45253981 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1108354926 13:49621422-49621444 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1108362005 13:49676478-49676500 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1108410613 13:50142812-50142834 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1108596257 13:51952246-51952268 GCTGCTGCTGAAGCTGGCCCTGG - Intronic
1108723871 13:53160176-53160198 GCTGCTGGGGAGGCTGACACAGG - Intergenic
1109278278 13:60325975-60325997 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1109404976 13:61886224-61886246 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1109431987 13:62248488-62248510 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1109479132 13:62926082-62926104 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1109632034 13:65062324-65062346 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1109679645 13:65733263-65733285 GCTGGTGATGAGGCAAACCTGGG + Intergenic
1110403049 13:75116201-75116223 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
1110851586 13:80252222-80252244 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1111346880 13:86968528-86968550 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1112337603 13:98527739-98527761 GGTGCTGGTGAGGCAGTGCTGGG - Intronic
1112371858 13:98801175-98801197 GCTACTGGGGAGGCTGACACAGG + Intronic
1112574469 13:100623342-100623364 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1112960208 13:105114899-105114921 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG + Intronic
1113475776 13:110580134-110580156 GCTACTTGTGAGGCTGACGCAGG - Intergenic
1113693366 13:112327466-112327488 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1113844842 13:113381011-113381033 GCTACTCGGGAGGCAGACGCAGG + Intergenic
1113892611 13:113744262-113744284 GCAGCTGGTGAGCCACTCCCTGG - Intergenic
1113942268 13:114024549-114024571 GCCCCTGGAGGGGCAGACCCAGG + Intronic
1114507231 14:23226517-23226539 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1114546777 14:23508713-23508735 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1114634349 14:24178953-24178975 CCAGCTGGTCAGGCAGACCCTGG - Intronic
1114636776 14:24191926-24191948 GCTACTTGGGAGGCTGACCCAGG - Intronic
1114989846 14:28273060-28273082 GCTGCTGGGGAGGCTGAGTCAGG - Intergenic
1115187043 14:30700560-30700582 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1115558695 14:34563848-34563870 GCTACTGGGGAGGCTGACGCAGG - Intronic
1115652611 14:35413869-35413891 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1115675548 14:35669364-35669386 GCTACTGGGGAGGCTGACACAGG - Intronic
1115844652 14:37514731-37514753 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1116051958 14:39814836-39814858 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1116219844 14:42069388-42069410 GCTACTCGTGAGGCAGAGGCAGG + Intergenic
1116456380 14:45125026-45125048 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1116918519 14:50548619-50548641 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1117107645 14:52414662-52414684 GCTGCTGGTGAGGCTGAGGCAGG + Intergenic
1117294794 14:54369477-54369499 GCTACTTGGGAGGCAGAGCCAGG - Intergenic
1117371891 14:55086205-55086227 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
1117560971 14:56938283-56938305 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1117656064 14:57958167-57958189 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1117890490 14:60416671-60416693 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1117991546 14:61438929-61438951 ACTTCTGGTGAGGCAGACCAGGG + Intronic
1118138042 14:63049345-63049367 GCTGCTAGTGAGGCCAACCTTGG - Intronic
1118267667 14:64310581-64310603 GCTGCTTGGGAGGCAGAGGCAGG - Intronic
1118463534 14:66009790-66009812 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1118562508 14:67101981-67102003 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1118647659 14:67855340-67855362 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1118791507 14:69097696-69097718 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1118819336 14:69334808-69334830 GCTGTTTGTGAGACAGCCCCTGG - Intronic
1118993412 14:70816343-70816365 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1119247040 14:73119375-73119397 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1119256354 14:73201197-73201219 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1119293920 14:73517972-73517994 GCTACTCGTGAGGCAGAGGCAGG + Intronic
1119349790 14:73954730-73954752 GCTGCTGGGGAGGCTGAGACAGG + Intronic
1119452734 14:74725822-74725844 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1119878447 14:78080228-78080250 GCTACTGGAGAGGCAGAGGCAGG - Intergenic
1120115889 14:80617340-80617362 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1120446033 14:84597497-84597519 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1120603133 14:86537463-86537485 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1120904892 14:89611692-89611714 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1121050870 14:90818016-90818038 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1121067567 14:90982999-90983021 GCTGCTCGGGAGGCTGACGCAGG + Intronic
1121077445 14:91081089-91081111 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1121080753 14:91106194-91106216 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1121085303 14:91141661-91141683 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1121196818 14:92080643-92080665 GCTGCTTGGGAGGCTGAGCCAGG - Intronic
1121207751 14:92183648-92183670 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1121644160 14:95506522-95506544 GCTGCTGGTGGGTCAGCCCTTGG - Intergenic
1121666766 14:95678159-95678181 GGAGCTGGTGAGGGAGAACCAGG - Intergenic
1121981795 14:98460904-98460926 GCTGCTGAAGGGGCAGCCCCAGG - Intergenic
1122728445 14:103776758-103776780 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1202872923 14_GL000225v1_random:180590-180612 GCTGCTCGGGAGGCTGAGCCAGG + Intergenic
1123713992 15:23013339-23013361 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1123831596 15:24144999-24145021 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1123836563 15:24200987-24201009 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1123851554 15:24362307-24362329 GCTGCTCGGGAGGCAGAGGCAGG - Intergenic
1123995558 15:25715798-25715820 CCTGCTGGAAGGGCAGACCCAGG + Intronic
1124048640 15:26175081-26175103 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1124342118 15:28896389-28896411 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1124702687 15:31930294-31930316 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1124778853 15:32610606-32610628 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1124848652 15:33314800-33314822 GCTGCTCGGGAGGCAGAGGCGGG + Intronic
1124927208 15:34082324-34082346 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1125264254 15:37861649-37861671 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1125626050 15:41109981-41110003 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125686323 15:41565518-41565540 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1125702960 15:41704544-41704566 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
1125712146 15:41795716-41795738 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1125795003 15:42397530-42397552 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1125813407 15:42562481-42562503 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1125815112 15:42577263-42577285 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1125911300 15:43442195-43442217 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1126048007 15:44662554-44662576 GCTGCTGGGGAGGCTGAGCCCGG + Intronic
1126151661 15:45528676-45528698 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1126589736 15:50326548-50326570 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1127106452 15:55621545-55621567 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1127397846 15:58557494-58557516 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1127502188 15:59564623-59564645 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1127516364 15:59696913-59696935 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1127669126 15:61177848-61177870 GCTGCTCGGGAGGCTGAGCCAGG + Intronic
1127906221 15:63378274-63378296 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1127991785 15:64124393-64124415 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128018857 15:64372500-64372522 GCTGCTGGGGAGGCTGAGGCGGG + Intronic
1128091009 15:64918840-64918862 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1128395061 15:67216328-67216350 GCTACTGGGGAGGCTGACGCAGG + Intronic
1128509691 15:68305807-68305829 GGCGCTGGGGAGGCAGAGCCAGG - Intronic
1128895138 15:71366183-71366205 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1129095012 15:73197245-73197267 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1129373382 15:75111709-75111731 GCTGCTGGGGAGGCTGAGACAGG + Intronic
1129595590 15:76961503-76961525 TCTGCTGGGGAAACAGACCCAGG - Intergenic
1129863504 15:78883101-78883123 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1129904933 15:79179827-79179849 GAGGCTGGTGAGATAGACCCTGG - Intergenic
1129994377 15:79991762-79991784 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1130073267 15:80666865-80666887 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1130242645 15:82210748-82210770 GCTACTCGTGAGGCTGAACCTGG + Intronic
1130826197 15:87548674-87548696 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1131168125 15:90157431-90157453 GCTACTCGGGAGGCTGACCCAGG - Intergenic
1131479050 15:92766735-92766757 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1131542284 15:93284565-93284587 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1131709806 15:95040737-95040759 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1131732883 15:95300638-95300660 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1132005750 15:98225584-98225606 ACAGCTGGAGAGGCAGACACTGG + Intergenic
1132007672 15:98244357-98244379 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1132057751 15:98665067-98665089 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1132226304 15:100144436-100144458 GCTTCTTGTGAGGCTGACGCAGG + Intronic
1132409675 15:101567414-101567436 CCTGATGGTGAGGCAGCCCAAGG - Intergenic
1132447532 15:101939171-101939193 GCTGCTGGGGAGGCCGAGGCGGG - Intergenic
1132529817 16:441050-441072 GCTACTCGGGAGGCAGACGCGGG - Intronic
1132587696 16:713206-713228 GCTGCTCGGGAGGCTGACGCAGG + Intronic
1132697797 16:1209699-1209721 GCTGCTGCCGAGGCAGGGCCAGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132823697 16:1891700-1891722 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1132978745 16:2723677-2723699 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1132988172 16:2778773-2778795 GCTGCTCGAGAGGCTGAGCCAGG + Intergenic
1133059920 16:3167685-3167707 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1133089245 16:3390593-3390615 GCTGCTGATGCGGCTGGCCCAGG - Intronic
1133124874 16:3640290-3640312 GCAGCTGCAGAGGCAGAGCCAGG - Intronic
1133209419 16:4255018-4255040 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1133334374 16:4997208-4997230 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1133503226 16:6385469-6385491 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1133603171 16:7359870-7359892 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1133727244 16:8549068-8549090 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1133750815 16:8723950-8723972 GCTACTGGGGAGGCTGACACAGG - Intronic
1134123664 16:11601681-11601703 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1134480911 16:14618374-14618396 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1134527496 16:14955611-14955633 GCTACTGGAGAGGCTGAGCCAGG - Intergenic
1134589135 16:15437844-15437866 GCTGCCGGGGAGGCTGACACAGG + Intronic
1134798506 16:17063290-17063312 GTGGGTGGTGAGGCAGACACTGG + Intergenic
1135048219 16:19171433-19171455 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1135091521 16:19521880-19521902 GCTGCTGGTGACGCGGAGCCCGG - Exonic
1135228557 16:20683227-20683249 GCTGCTGGAGAGGCTGAGACAGG - Intronic
1135229584 16:20693056-20693078 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1135262428 16:20992455-20992477 GCTGCTGGGGAGGCTGAGGCGGG - Intronic
1135509587 16:23070600-23070622 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1135554527 16:23424896-23424918 GGTGCTGCTGATTCAGACCCTGG - Exonic
1135635767 16:24074021-24074043 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1135756263 16:25100985-25101007 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1136027334 16:27477416-27477438 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1136059605 16:27717586-27717608 ACTGATGCTGAGCCAGACCCGGG - Intronic
1136179643 16:28542233-28542255 GCTGCTGGGGAGGCTGAGGCTGG + Intergenic
1136396948 16:29997968-29997990 GCTACTTGGGAGGCAGAACCAGG + Intronic
1136584105 16:31172686-31172708 GCTGCTGGGGAGGCTGAGACGGG + Intergenic
1136657472 16:31718808-31718830 GGTGCTGGTGAGGGAGTTCCTGG - Intronic
1137234746 16:46606930-46606952 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1137311120 16:47260048-47260070 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1137626683 16:49913300-49913322 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1137677002 16:50308723-50308745 GCCCCTGCTGAGGCTGACCCTGG + Exonic
1137823193 16:51464882-51464904 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1138093611 16:54195314-54195336 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG + Intergenic
1138675751 16:58649878-58649900 GCTGCGGGCAAGGCAGACTCAGG + Intergenic
1138677098 16:58659529-58659551 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1138869746 16:60867701-60867723 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1139132394 16:64162222-64162244 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1139625635 16:68186426-68186448 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1139654279 16:68377877-68377899 TCTGCTGGTAAGGCAAGCCCTGG + Intronic
1139704178 16:68729191-68729213 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1139790001 16:69426285-69426307 GCTGCTCGTGAGGCTGAGGCAGG + Intronic
1140059559 16:71556074-71556096 GCTGCTCGGGAGGCTGACGCAGG + Intronic
1140235319 16:73153540-73153562 GCTGCAGGTGAGGAAGACTTGGG + Intergenic
1140489015 16:75318515-75318537 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1140544892 16:75797993-75798015 GCTGCTGGTGAGGTGGACAGTGG + Intergenic
1140590185 16:76342582-76342604 GCTGCTTGGGAGGCTGACACAGG - Intronic
1140731322 16:77859186-77859208 GCTACTGGGGAGGCTGACGCAGG + Intronic
1140746856 16:77988164-77988186 GCTGCTGCTCAGGCTGACCGCGG + Intergenic
1140884703 16:79232950-79232972 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1140899005 16:79351054-79351076 GCTGATGGAGAGGCAGAGCAAGG - Intergenic
1141181990 16:81760012-81760034 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1141542071 16:84732556-84732578 GCTGCTCGGGAGGCTGAGCCAGG - Intronic
1141996222 16:87638029-87638051 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142041689 16:87898269-87898291 GCTGCAGGTGAGCCCGTCCCTGG + Intronic
1142351463 16:89582706-89582728 GCTGCTGGCCAGGCCGGCCCTGG + Intronic
1142382739 16:89742906-89742928 GGTGCTGGGGAGGCAGCCTCAGG + Exonic
1142475985 17:190262-190284 GCTGCTGGGGAGGCTGAGGCGGG + Intergenic
1142592952 17:1014732-1014754 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1142647315 17:1323081-1323103 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1142663617 17:1448509-1448531 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1142716074 17:1747674-1747696 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1142716663 17:1750805-1750827 GCTGTGGGTGAGGCTGGCCCGGG + Intronic
1142729374 17:1841413-1841435 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1142837356 17:2596947-2596969 GCTGCTGGGGAGGCTGAGACAGG + Intronic
1142867566 17:2799969-2799991 CCTGCTCCTGGGGCAGACCCTGG - Intronic
1143092377 17:4456635-4456657 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1143160610 17:4867698-4867720 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1143294145 17:5857933-5857955 GCTGCTGGTGGGGACAACCCAGG + Intronic
1143618943 17:8070193-8070215 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1143628272 17:8123036-8123058 GCTGCTGCTGGAGCGGACCCGGG - Exonic
1143716150 17:8771227-8771249 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1144411824 17:15009127-15009149 ACAGCTGGAGAGACAGACCCTGG + Intergenic
1144416941 17:15057480-15057502 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1144417257 17:15061094-15061116 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1144574750 17:16422209-16422231 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1144697970 17:17318366-17318388 GCTACTTGGGAGGCTGACCCAGG + Intronic
1144785501 17:17829079-17829101 GCTGCTTGGGAGGCTGACGCAGG + Intronic
1144959461 17:19036739-19036761 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1144975698 17:19137785-19137807 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1145004923 17:19332395-19332417 GCTGGGGGTGAGGAAGAGCCAGG + Intronic
1145039358 17:19565690-19565712 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1145088745 17:19968087-19968109 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1145186818 17:20801991-20802013 GCTGCTCGGGAGGCTGACGCAGG + Intergenic
1146376461 17:32298125-32298147 GCTGCTGGTGGGGGTGCCCCTGG + Exonic
1146549458 17:33768118-33768140 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1146790608 17:35748539-35748561 GTTTCTGGTGAGGCACAGCCAGG + Intronic
1146858854 17:36278650-36278672 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1146970955 17:37072037-37072059 GCTGCTTGAGAGGCAGAGGCAGG - Intergenic
1147059017 17:37859091-37859113 GCTGCTTGTGAGGCTGAGCAGGG + Intergenic
1147089176 17:38082735-38082757 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1147108033 17:38237782-38237804 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1147176644 17:38659929-38659951 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1147235707 17:39055873-39055895 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1147290931 17:39442483-39442505 GCTGCTTGGGAGGCTGAGCCAGG + Intronic
1147426758 17:40349479-40349501 GCTGCTGGTGAGTCAGAAATAGG - Intronic
1147428829 17:40359188-40359210 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1147611464 17:41804061-41804083 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1147798269 17:43061692-43061714 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1147847626 17:43415994-43416016 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1147872478 17:43597417-43597439 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1147995369 17:44357233-44357255 GCTGCTCGTGAGGCTGAGGCAGG + Intronic
1148158825 17:45438418-45438440 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1148329346 17:46804197-46804219 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1148380399 17:47192536-47192558 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1148633944 17:49132897-49132919 GGTGCTGGGGACGCAGACGCCGG + Intronic
1148658010 17:49302848-49302870 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1148688084 17:49512003-49512025 GCTGCTGGTCATGCAGGCTCTGG - Exonic
1148890745 17:50805571-50805593 GTTGCTGGTCAGACAGACACTGG + Intergenic
1149009396 17:51839379-51839401 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1149706720 17:58701394-58701416 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1149790558 17:59473103-59473125 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1149890908 17:60389903-60389925 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1150044257 17:61896126-61896148 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1150107638 17:62474188-62474210 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1150111335 17:62503169-62503191 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1150138354 17:62708355-62708377 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1150173015 17:63020036-63020058 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1150181265 17:63123445-63123467 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1150312920 17:64144096-64144118 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1150499061 17:65632457-65632479 GCTGCTTGGGAGGCTGACACAGG - Intronic
1150671845 17:67207329-67207351 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1150743250 17:67796513-67796535 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1150746056 17:67817655-67817677 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1150746291 17:67819486-67819508 GCTGCTTGGGAGGCTGACGCAGG + Intergenic
1150792439 17:68209303-68209325 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1150971671 17:70035568-70035590 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1151054016 17:71011298-71011320 GCTACTCGGGAGGCAGACGCAGG + Intergenic
1151175668 17:72285753-72285775 GCTGCTCGGGAGGCAGAGGCAGG + Intergenic
1151324288 17:73369341-73369363 GCTGCTGGTGCAGCGGGCCCGGG - Intronic
1151746611 17:76014974-76014996 GCTGCTGGCGAGGCAGGTCTTGG + Exonic
1151846618 17:76660370-76660392 GCTGGAGGAGAGGCAGTCCCAGG + Intergenic
1151906178 17:77050824-77050846 GCAGCTGTGGAGGCAGAACCAGG + Intergenic
1151977071 17:77489098-77489120 GCTGAGGGTCAGGCAGGCCCTGG + Intronic
1152262876 17:79276571-79276593 GCTGCTCGGGAGGCTGACGCAGG + Intronic
1152327407 17:79649592-79649614 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1152462561 17:80449252-80449274 GCTGCAAGGGAGGCAGGCCCAGG - Intergenic
1152653518 17:81508335-81508357 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1152674189 17:81628988-81629010 GCTGCTGGTGAGGCTGAGGCAGG - Intronic
1152678548 17:81653920-81653942 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1152693079 17:81729945-81729967 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1152747977 17:82049947-82049969 GCCTCTGCTGAGGCAGAACCCGG + Exonic
1152765127 17:82132869-82132891 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1152802461 17:82337394-82337416 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1152999489 18:441134-441156 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1153202752 18:2662531-2662553 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
1153241238 18:3033200-3033222 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1153272464 18:3336190-3336212 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1153609098 18:6864175-6864197 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1153981778 18:10316618-10316640 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154219225 18:12437493-12437515 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1154460605 18:14580998-14581020 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1154484322 18:14860814-14860836 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1154962586 18:21324696-21324718 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1154994349 18:21625720-21625742 GCTACTGGAGAGGCAGAGGCAGG - Intronic
1155010915 18:21776863-21776885 GCTACTGGGGAGGCAGAGGCAGG + Intronic
1155992941 18:32299400-32299422 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1156050524 18:32928038-32928060 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1156442346 18:37203919-37203941 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1157707010 18:49815095-49815117 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1157784452 18:50469475-50469497 GATGATGGGGAGGCAGAGCCAGG + Intergenic
1157838122 18:50927588-50927610 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1157976301 18:52330959-52330981 ACTGCTGGTCAGGCTGCCCCCGG - Intergenic
1158032050 18:52977771-52977793 GCTACTCGTGAGGCTGACGCAGG + Intronic
1158058480 18:53311231-53311253 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1158468947 18:57717434-57717456 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1159041954 18:63332718-63332740 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1159145176 18:64445102-64445124 GCAGCAGGGGAGGCAGACACAGG - Intergenic
1159166373 18:64706039-64706061 GCTGCTCGTGAGGCTGAGGCAGG + Intergenic
1159452289 18:68617957-68617979 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1159909926 18:74136291-74136313 GCTGCTGGGGAGGCTGAGGCGGG - Intronic
1160490576 18:79334243-79334265 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1160500525 18:79399518-79399540 GCGGCGGGAGAGGCAGGCCCAGG + Intronic
1160637740 19:93358-93380 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
1160813522 19:1024760-1024782 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1160915529 19:1494794-1494816 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1160923311 19:1530729-1530751 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1160958194 19:1704922-1704944 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1160969666 19:1761972-1761994 GCTGCTGGAGAGGCGTGCCCGGG + Intronic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161033665 19:2072065-2072087 GCTGCTGGGGAGGCTGAGGCAGG + Exonic
1161083600 19:2323560-2323582 GCTGCTCGGGAGGCTGACGCAGG - Intronic
1161179260 19:2868526-2868548 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1161184824 19:2910570-2910592 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1161202127 19:3020975-3020997 GCTACTCGTGAGGCTGACACAGG + Intronic
1161212108 19:3072400-3072422 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1161289554 19:3485770-3485792 GGTGGTGGTGAGGAAGACCTGGG + Intergenic
1161418359 19:4160843-4160865 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1161541506 19:4854513-4854535 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1161660392 19:5542210-5542232 GCTACTCGTGAGGCTGAGCCAGG + Intergenic
1161725782 19:5927770-5927792 GCTGCTGGTGGGGAAGTGCCAGG + Intronic
1161784516 19:6315489-6315511 GCTGCTGGGGAGGCTGAGTCAGG - Intronic
1161818171 19:6513024-6513046 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1161991749 19:7688331-7688353 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1162031528 19:7919492-7919514 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1162048354 19:8016494-8016516 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1162085310 19:8245360-8245382 GCTACTCGTGAGGCAGAGGCAGG - Intronic
1162105916 19:8369563-8369585 GCTACTGGGGAGGCTGACGCTGG - Intronic
1162135263 19:8551461-8551483 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1162336822 19:10066738-10066760 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1162397553 19:10425873-10425895 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1162443035 19:10705025-10705047 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1162489297 19:10982609-10982631 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1162493241 19:11007627-11007649 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1162543076 19:11309991-11310013 GCTGCTTGGGAGGCTGACGCAGG + Intronic
1162626177 19:11887033-11887055 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1162792460 19:13070125-13070147 GCTCCTGGGGAGGCAGCTCCTGG - Intronic
1162983562 19:14254918-14254940 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1163285036 19:16341334-16341356 GCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1163309384 19:16504064-16504086 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1163367887 19:16886236-16886258 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1163617394 19:18337661-18337683 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1163680731 19:18680775-18680797 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1163814735 19:19457627-19457649 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1163855129 19:19695742-19695764 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1163856095 19:19703490-19703512 GCTGCTAGGGAGGCTGAGCCAGG - Intergenic
1164079911 19:21853086-21853108 GCTACTCGGGAGGCAGAGCCAGG + Intergenic
1164179050 19:22803842-22803864 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1164380108 19:27727669-27727691 GCTACTTGTGAGGCTGACGCAGG + Intergenic
1165048723 19:33127402-33127424 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1165189146 19:34047868-34047890 GCTACTCGTGAGGCAGAGGCAGG - Intergenic
1165243626 19:34485192-34485214 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1165337303 19:35180330-35180352 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1165491556 19:36126308-36126330 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1165556130 19:36634100-36634122 GCTGCTGATGAAGCAGAGCTAGG - Intergenic
1165566707 19:36735611-36735633 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1165666083 19:37629706-37629728 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1165726762 19:38118311-38118333 GCTACTGGGGAGGCAGAGACAGG + Intronic
1165757563 19:38303197-38303219 GCTACTTGGGAGGCTGACCCAGG - Intronic
1166045659 19:40228871-40228893 GCTACTGGTGAGGCTGAGACAGG + Intergenic
1166149256 19:40859802-40859824 GCTACTGGGGAGGCTGACACAGG - Intronic
1166374256 19:42318254-42318276 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1166421775 19:42641864-42641886 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1166666932 19:44685745-44685767 GCTACTGGAGAGGCAGAGGCAGG + Intergenic
1166758939 19:45212704-45212726 GCTACTGGTGAGGCTGAGGCTGG - Exonic
1166858773 19:45797266-45797288 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167450810 19:49567781-49567803 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1167495449 19:49815573-49815595 GCTACTGGGGAGGCAGAGGCAGG + Intronic
1167553494 19:50177623-50177645 GCTGCTGGGGAGGCTGAGGCGGG - Intergenic
1167582450 19:50353797-50353819 GCTGCTTGGGAGGCTGACGCAGG + Intronic
1167755376 19:51409913-51409935 GCTACTTGGGAGGCAGACGCAGG - Intergenic
1167889108 19:52525948-52525970 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1167923343 19:52802870-52802892 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1167983062 19:53292054-53292076 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1168011435 19:53536789-53536811 GCTACTGGGGAGGCTGACGCAGG + Intronic
1168029890 19:53671055-53671077 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1168045641 19:53792426-53792448 GCTGCTGGGGAGGCTGAGGCGGG - Intergenic
1168046248 19:53796361-53796383 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1168437244 19:56328881-56328903 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1168476511 19:56679324-56679346 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1168506011 19:56935776-56935798 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1168525254 19:57083504-57083526 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1168599788 19:57708459-57708481 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1168623629 19:57898827-57898849 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1168635588 19:57993842-57993864 GCTCCTGGTGAGGCATGCCCTGG - Intronic
1202707814 1_KI270713v1_random:36199-36221 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
925490398 2:4385993-4386015 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
925736666 2:6969871-6969893 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
925997927 2:9307052-9307074 GCTGCTGGTGCAGCTGGCCCAGG - Intronic
926154495 2:10445745-10445767 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
926180567 2:10639308-10639330 GCTGCTGGGGAGGCTGAGACAGG + Intronic
926990765 2:18677297-18677319 GCTGCTGGAGGGGCAAAGCCAGG + Intergenic
927002086 2:18806999-18807021 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
927451828 2:23215353-23215375 GCTGCTGGGGAGGCAGTCACTGG + Intergenic
927687848 2:25184404-25184426 GGTGATGGTGACGCAGACCAGGG + Intergenic
927755898 2:25707662-25707684 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
927858544 2:26542962-26542984 TCTGCTGGTGACTCAGACCTGGG + Intronic
927986961 2:27418323-27418345 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
928173986 2:29021969-29021991 GCTCCTGGGGAGGGAGGCCCAGG + Intronic
928183164 2:29084176-29084198 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
928435537 2:31252247-31252269 GCTCATGGTGATCCAGACCCAGG - Intronic
928571586 2:32614718-32614740 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
928877237 2:36054225-36054247 GCTGCTGGTATGGCAAAACCAGG + Intergenic
928998922 2:37325881-37325903 GCTGCTTGGGAGGCTGACGCAGG - Intergenic
929115482 2:38440508-38440530 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
929645290 2:43620073-43620095 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
930047385 2:47184860-47184882 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
930070074 2:47359078-47359100 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
930179474 2:48338511-48338533 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
930330553 2:49978048-49978070 GCTACTTGGGAGGCAGAGCCAGG + Intronic
930489679 2:52052346-52052368 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
930534210 2:52627739-52627761 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
930767942 2:55104160-55104182 GCTGCTGGGGAGGCTGACCCAGG - Intronic
931349856 2:61477340-61477362 GCTGCTTGGGAGGCTGAGCCAGG - Intergenic
931350065 2:61479675-61479697 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
931767455 2:65469578-65469600 GCTGCTTGGGAGGCTGACGCAGG - Intergenic
931883639 2:66592287-66592309 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
932233653 2:70103534-70103556 GCTACTGGGGAGGCTGACGCAGG - Intergenic
932239348 2:70144721-70144743 GCTACTGGTGAGGCCGAGGCAGG + Intergenic
932588832 2:73050497-73050519 GCTGTGGCTCAGGCAGACCCAGG - Intronic
932613941 2:73220121-73220143 GCTCTGGGTGAGGCAGAACCTGG - Exonic
932744746 2:74324522-74324544 GCTGCTGATGATGCTGATCCAGG + Intronic
932904180 2:75731961-75731983 GATGCTGGAGAGGCAGGCCAGGG + Intergenic
932909566 2:75791634-75791656 GCTGCTTGTGAGGCTGAGGCAGG - Intergenic
933300952 2:80540483-80540505 GCTACTGGTGAGGCTGAGACAGG + Intronic
934507909 2:94909777-94909799 GCTACTCGTGAGGCAGAGGCAGG - Intergenic
934528275 2:95066722-95066744 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
934638557 2:96011827-96011849 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
934659797 2:96137356-96137378 GCTGCTCGGGAGGCAGAGGCAGG + Intronic
934710137 2:96509022-96509044 GCTGCTTAGGCGGCAGACCCGGG - Intergenic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
934795093 2:97093584-97093606 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
934907183 2:98215627-98215649 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
934995518 2:98954812-98954834 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
935023074 2:99250484-99250506 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
935228277 2:101073404-101073426 GCTACTGGGGAGGCTGAGCCAGG - Intronic
935711584 2:105903496-105903518 GCCGCTGGTGAGGAGCACCCAGG - Intergenic
935722494 2:105991775-105991797 TCTCCTGGGGAGGCAGACCACGG - Intergenic
935735445 2:106103365-106103387 GCCACTGGTGAGGCAGCCCGAGG + Intronic
935785262 2:106543170-106543192 GCTGCAGGTAAGGCAGTTCCCGG - Intergenic
935968023 2:108501105-108501127 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
936103390 2:109603344-109603366 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
936475698 2:112837858-112837880 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
936577708 2:113669518-113669540 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
937149798 2:119678806-119678828 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
937832795 2:126442354-126442376 GCTGCTTGAGAGGCTGAACCTGG - Intergenic
937979600 2:127607250-127607272 GCCGCTGGCGAGGCAGTACCAGG + Exonic
938092238 2:128441393-128441415 GCTGCTGTTGGGGCTGCCCCTGG + Intergenic
938103246 2:128512503-128512525 GATGGTGGTGAGGCCGGCCCTGG + Intergenic
938312757 2:130303920-130303942 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
938315814 2:130327358-130327380 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
938723569 2:134087370-134087392 GTGGCTGGGGAGGCAGACCCTGG - Intergenic
938870646 2:135472386-135472408 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
938927651 2:136059164-136059186 GCTGCTGCTTAGGCAGAACTGGG - Intergenic
939324313 2:140668196-140668218 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
939379441 2:141415124-141415146 GCTACTGGGGAGGCTGAGCCAGG - Intronic
939394267 2:141608110-141608132 GCTGCTTGTGAGGCTGAGGCAGG + Intronic
939616058 2:144363427-144363449 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
940133440 2:150409900-150409922 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
940242718 2:151580115-151580137 GCTACTGGGGAGGCAGAGGCAGG - Intronic
940243676 2:151590666-151590688 GCTACTGGGGAGGCAGAGGCAGG - Intronic
940244632 2:151601218-151601240 GCTACTGGGGAGGCAGAGGCAGG - Intronic
940867737 2:158834003-158834025 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
941294762 2:163723077-163723099 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
941348188 2:164396462-164396484 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
941444921 2:165588848-165588870 GCTACTGGTGAGGCAGAGGTGGG + Intronic
941475434 2:165946225-165946247 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
941591521 2:167426384-167426406 GCTACTCGCGAGGCAGAGCCAGG - Intergenic
941656648 2:168151625-168151647 GCTACTCGTGAGGCTGACGCAGG + Intronic
943507086 2:188774959-188774981 GCTGCTCGGGAGGCTGACGCAGG - Intronic
943547104 2:189293974-189293996 GCTACTGGTGAGGCTGAAGCAGG + Intergenic
943631065 2:190253075-190253097 GCTACTGGTGAGGCTGAGGCAGG + Intronic
943716644 2:191159963-191159985 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
944503333 2:200384463-200384485 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
944660812 2:201920227-201920249 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
944722079 2:202433794-202433816 GCTGCTCGGGAGGCTGAGCCAGG + Intronic
944727331 2:202484559-202484581 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
944814461 2:203361385-203361407 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
945068605 2:205968712-205968734 GCTGCTCGGGAGGCTGACGCAGG - Intergenic
945750576 2:213777516-213777538 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
945840645 2:214883836-214883858 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
945867926 2:215197097-215197119 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
946021332 2:216642416-216642438 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
946154217 2:217796536-217796558 GGTGGTGTTGAGGCAGAGCCCGG + Intergenic
946253324 2:218426711-218426733 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
946270166 2:218585459-218585481 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
946583157 2:221152898-221152920 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
946855853 2:223949086-223949108 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
947611689 2:231528672-231528694 GCTGCTGGTGGGCCTGCCCCTGG - Exonic
947628534 2:231636638-231636660 GCTACTTGTGAGGCTGACGCAGG + Intergenic
948196217 2:236098734-236098756 GCTACTGGGGAGGCTGACGCAGG - Intronic
948208637 2:236176925-236176947 GCTCAGGGTGAGGCAGAGCCGGG - Intergenic
948231140 2:236350564-236350586 GAGGCTGCTGAGGCAGAGCCAGG + Intronic
948393691 2:237629581-237629603 GCTACTGGTGAGGCTGAGGCAGG - Intronic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948466683 2:238155576-238155598 GCTGCTGGGAAGCCAGGCCCGGG + Intergenic
948659885 2:239500525-239500547 GCTGATGTTGAGGCAGACGCAGG + Intergenic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948798015 2:240414911-240414933 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
948845213 2:240679861-240679883 CATCCTGGTGGGGCAGACCCGGG - Intronic
948848647 2:240695018-240695040 CATCCTGGTGGGGCAGACCCGGG + Intronic
948858573 2:240742084-240742106 GCTGCTGCAGAGCCAGTCCCTGG - Intronic
948957011 2:241301086-241301108 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
948961551 2:241342645-241342667 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1168772188 20:422214-422236 GCTGCTGGAGAGGGAGATCAAGG + Exonic
1169100989 20:2948838-2948860 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1169503819 20:6186876-6186898 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1169760319 20:9084939-9084961 GCTGCTGGGGAGGCTGAGACAGG + Intronic
1169836516 20:9885719-9885741 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1170238205 20:14132017-14132039 GCTGCTGGGGAGGCTGAGGCGGG + Intronic
1170316722 20:15049834-15049856 GCTGCTCGGGAGGCAGAGGCAGG + Intronic
1170670462 20:18428037-18428059 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1171035208 20:21708291-21708313 GCTGCTGCTGAGTCAAAGCCTGG - Intronic
1171381554 20:24737751-24737773 GATGCTGGTGCAGCAAACCCAGG - Intergenic
1171504350 20:25621664-25621686 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1171508848 20:25662953-25662975 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1171946178 20:31379775-31379797 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1171961989 20:31501357-31501379 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1172115091 20:32568864-32568886 GCTGCTTGTGTGGGGGACCCTGG + Intronic
1172330453 20:34072308-34072330 GGTGCTGGCCGGGCAGACCCTGG + Exonic
1172451666 20:35029745-35029767 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1172799451 20:37565758-37565780 GCTGCTGGTGGCTCAGACCAAGG + Intergenic
1172801112 20:37576876-37576898 GCTGGTGGGGAGACAGACTCTGG - Intergenic
1173255933 20:41394370-41394392 CCTGCAGAAGAGGCAGACCCAGG - Intergenic
1173304215 20:41832642-41832664 GCTGCTGGTCAGGAGGAACCTGG + Intergenic
1173580943 20:44146143-44146165 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1173635295 20:44551163-44551185 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1173804152 20:45912919-45912941 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1173986599 20:47266390-47266412 GCTGCTTGTGAGGCTGAGGCAGG - Intronic
1174251799 20:49225565-49225587 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1174436262 20:50509519-50509541 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1174475536 20:50793597-50793619 GCTACTGGAGAGGCAGATGCAGG - Intergenic
1174758325 20:53181774-53181796 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1175166053 20:57045473-57045495 GCTGCTGATGCTGCAGGCCCGGG - Intergenic
1175763229 20:61575137-61575159 GCTGCTCCTGAAGCTGACCCTGG - Intronic
1175891124 20:62316501-62316523 GCTGCTTGTGTGTCAGCCCCGGG - Intronic
1175894739 20:62331055-62331077 GCTGCTGATGCAGCTGACCCGGG + Exonic
1175896708 20:62339347-62339369 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1176045690 20:63091452-63091474 GCTGCTGGTGATGCAGGGCAGGG - Intergenic
1176078754 20:63261212-63261234 GCTGCAGATGAGGCTGCCCCAGG + Intronic
1176177045 20:63733624-63733646 GCTGCTGCTGAGGGAGGCCGTGG + Exonic
1176797008 21:13378655-13378677 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1176937045 21:14879579-14879601 GCAGCTGGTGACCCAGACCCAGG + Intergenic
1176964108 21:15192894-15192916 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1177349150 21:19912582-19912604 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1177808255 21:25897222-25897244 GCTGCTGGGGAGGCTGACGCAGG - Intronic
1177818017 21:25999178-25999200 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1177934739 21:27330358-27330380 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1178860237 21:36282862-36282884 GCTACTGGGGAGGCAGAAGCAGG + Intronic
1178870858 21:36374199-36374221 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1179011468 21:37559496-37559518 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1179026811 21:37685566-37685588 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1179477279 21:41655150-41655172 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
1179541411 21:42085453-42085475 GCAGCTGCTCAGGCAGACCCAGG + Intronic
1179714144 21:43279159-43279181 GCAGCTGGTGTGGCAGAGGCAGG + Intergenic
1179827842 21:43977773-43977795 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1179891819 21:44339102-44339124 ACTGCTGGTGAGGCGGGGCCTGG - Exonic
1179989912 21:44942418-44942440 GCTGTGGGTGAGGGAGACCAAGG + Intronic
1180193650 21:46181286-46181308 GCTGATGGAGACGCAGAACCTGG + Intronic
1180251656 21:46594177-46594199 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1180639153 22:17284108-17284130 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1180662740 22:17482790-17482812 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1180677158 22:17595157-17595179 GCTACTGGGGAGGCTGACGCAGG - Intronic
1180793693 22:18591557-18591579 GCTGCTTGGGAGGCTGACCTGGG + Intergenic
1180856325 22:19048079-19048101 GCTACTGGTGAGGCTGAGGCAGG + Intronic
1180985287 22:19900636-19900658 GCTGCTGGGGAGGCCGAGACAGG + Intronic
1181104628 22:20566625-20566647 GCAGCTGCTGGGGCAGAGCCTGG - Exonic
1181135076 22:20759513-20759535 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1181228046 22:21403756-21403778 GCTGCTTGGGAGGCTGACCTGGG - Intergenic
1181298677 22:21863376-21863398 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1181449370 22:23008195-23008217 AGTGCTGAAGAGGCAGACCCAGG - Intergenic
1181530627 22:23515199-23515221 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1181775128 22:25153880-25153902 CCTTGGGGTGAGGCAGACCCGGG - Intronic
1181784696 22:25218552-25218574 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1181816646 22:25442577-25442599 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1181922121 22:26328672-26328694 GCTGCCCGTGGGGCAGGCCCAGG + Intronic
1182092665 22:27606581-27606603 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1182537761 22:31018120-31018142 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1182564710 22:31189012-31189034 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1182580470 22:31306462-31306484 GCTGCTCGTGAGGCTGAGGCAGG - Intergenic
1183185175 22:36287628-36287650 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1183403035 22:37615950-37615972 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1183483412 22:38076934-38076956 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
1183558613 22:38551970-38551992 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1183804401 22:40195879-40195901 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1183901367 22:41008468-41008490 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1183926723 22:41211666-41211688 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1183989382 22:41588160-41588182 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1184055735 22:42047731-42047753 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1184087738 22:42275306-42275328 GCTGCTTGTTGGGCAGACCGTGG - Intronic
1184153796 22:42653715-42653737 GCTGACTGTGAGGCAGCCCCGGG + Intergenic
1184170029 22:42753310-42753332 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1184193092 22:42908223-42908245 GCTTTTGTTGAGGCAGACTCAGG + Intronic
1184194945 22:42921245-42921267 GCTGCTCGGGAGGCTGAGCCAGG + Intronic
1184567947 22:45304221-45304243 GCTGCTCGTGAGGCTGAGGCAGG - Intergenic
1184594540 22:45505881-45505903 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1184597594 22:45523590-45523612 GCTGCCGGTGAGGCTGAGGCAGG + Intronic
1184696466 22:46142136-46142158 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1185138880 22:49089320-49089342 GCCTCTGCTGGGGCAGACCCTGG - Intergenic
1185353580 22:50351903-50351925 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
949742604 3:7253503-7253525 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
950058247 3:10046163-10046185 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
950610957 3:14126143-14126165 GCTGTGGGTGATGCACACCCTGG - Intronic
950674430 3:14546088-14546110 GATGCTGGTGAAGGAGACCTGGG - Intergenic
950759981 3:15213990-15214012 GCTACTGGGGAGGCTGACGCAGG - Intronic
950784472 3:15422511-15422533 GCTGCTTGAGAGGCAGAGGCAGG + Intronic
951695121 3:25438300-25438322 TCTGCTGGTGAAGCAGACACAGG + Intronic
951717855 3:25667414-25667436 GCTACTGGGGAGGCAGACATAGG + Intergenic
952140516 3:30473748-30473770 GCAGCTGGGGAGGCAAACCTGGG - Intergenic
952199830 3:31114660-31114682 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
952298116 3:32079642-32079664 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
952396296 3:32923199-32923221 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
952460744 3:33522962-33522984 GCTGCTGGGGAGGCTGAGACAGG + Intronic
952856882 3:37779214-37779236 GCTGCTGGGGAGGCTGAGGCGGG - Intronic
952879417 3:37974194-37974216 TCTGCTGGTGAGGCTAACCAGGG - Intronic
952924895 3:38313567-38313589 GCTGCAGGGGAGGCAGCCCAAGG + Intronic
953141685 3:40234880-40234902 GCTACTTGGGAGGCTGACCCAGG + Intronic
953314980 3:41918711-41918733 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
953524218 3:43674394-43674416 GCTACTTGTGAGGCAGAGGCAGG - Intronic
953705874 3:45229849-45229871 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
953908167 3:46878772-46878794 CCTGCTGGTGTGGCAGCCCCAGG - Intronic
953956906 3:47238771-47238793 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
953963541 3:47284445-47284467 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
954095104 3:48320016-48320038 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
954161382 3:48725092-48725114 GCTACTGGGGAGGCAGAGGCGGG + Intronic
954221448 3:49156985-49157007 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
954341149 3:49954868-49954890 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
955169744 3:56551587-56551609 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
955248587 3:57253972-57253994 GCTACTGGTGAGGCTGAAGCAGG - Intronic
955949224 3:64225323-64225345 GCTGATCCTGAGCCAGACCCGGG + Exonic
956175851 3:66472190-66472212 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
956503439 3:69911412-69911434 GCTACTGGGGAGGCAGAGGCAGG - Intronic
957452358 3:80395933-80395955 GCTACTTGTGAGGCAGAGGCAGG + Intergenic
957558605 3:81792845-81792867 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
957676204 3:83368634-83368656 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
957679995 3:83421606-83421628 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
957684122 3:83477844-83477866 GCTGCTCGGGAGGCTGACGCAGG + Intergenic
958117652 3:89242547-89242569 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
958579548 3:96000213-96000235 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
958596186 3:96227029-96227051 GCTGCTTGGGAGGCAGAGGCAGG - Intergenic
958597911 3:96253987-96254009 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
959472435 3:106768373-106768395 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
960038687 3:113127560-113127582 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
960047167 3:113210096-113210118 GCTGCTTGGGAGGCTGACACTGG + Intergenic
960106046 3:113798019-113798041 GCTACTGGTGAGGCTGAGTCAGG + Intronic
960319737 3:116220070-116220092 GCTACTTGTGAGGCTGAGCCAGG + Intronic
961197286 3:125013426-125013448 GGTGATGGTGAGGAAGACCATGG + Exonic
961693380 3:128686604-128686626 GCTACTGGGGAGGCTGAGCCAGG + Intergenic
961750962 3:129094624-129094646 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
962014504 3:131426145-131426167 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
962224785 3:133596929-133596951 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
962282034 3:134059402-134059424 TTAGCTGGTGAGGCAGCCCCAGG - Intergenic
962529545 3:136266238-136266260 GCTGCTCGGGAGGCAGAGGCAGG - Intronic
962601269 3:136992403-136992425 GCTGCAGGAGAGGCAGCCACAGG + Intronic
962718318 3:138147947-138147969 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
962797540 3:138862201-138862223 GCTGCTGGGGAGGCTGAGGCGGG - Intergenic
963038961 3:141054851-141054873 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
963176753 3:142305726-142305748 GCTACTGGGGAGGCTGACGCAGG + Intergenic
963200617 3:142582147-142582169 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
963407439 3:144884459-144884481 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
964058305 3:152488948-152488970 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
964086277 3:152822753-152822775 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
964318047 3:155464995-155465017 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
964335507 3:155649864-155649886 GCTGCTGGGGAGGCTGAGACAGG + Intronic
964349430 3:155788077-155788099 GCTACTGGGGAGGCTGAGCCAGG + Intronic
964454974 3:156854253-156854275 GCTACTTGTGAGGCTGACGCAGG - Intronic
964608791 3:158587887-158587909 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
965008194 3:163053721-163053743 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
965071015 3:163915230-163915252 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
965579490 3:170252100-170252122 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
965587926 3:170335300-170335322 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
965797625 3:172457568-172457590 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
966003582 3:174980386-174980408 GCTGCTGCAGAGGCTGAGCCAGG + Intronic
966042356 3:175507532-175507554 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
966184686 3:177217138-177217160 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
966393947 3:179482012-179482034 GCTACTGGGGAGGCTGAGCCGGG - Intergenic
966973217 3:185064165-185064187 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
967036390 3:185651452-185651474 GCTACTGGGGAGGCAGAGGCAGG - Intronic
967165262 3:186774268-186774290 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
967354271 3:188550464-188550486 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
967802372 3:193676867-193676889 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968143260 3:196275983-196276005 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
968159854 3:196417199-196417221 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
968167584 3:196479700-196479722 GCTACTGGGGAGGCTGAGCCAGG - Intronic
968215334 3:196884782-196884804 GCTCCTGGTGAGGCTGAGGCAGG - Intronic
968499502 4:941262-941284 GCTGCTCGGGAGGCTGACACAGG + Intronic
968640212 4:1710937-1710959 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
968676135 4:1881372-1881394 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
968828864 4:2921237-2921259 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
968836791 4:2970779-2970801 GCTGCTGGGGAGGCTGAGACAGG - Intronic
968871656 4:3245707-3245729 GCTGCTGGGGCTGCAGAGCCTGG - Intronic
969275999 4:6136132-6136154 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
969370026 4:6725371-6725393 GCTGGTGGAGAAGCAGTCCCGGG - Intergenic
969487073 4:7478312-7478334 GGAGCTGGTGACGCAGACCATGG - Intronic
969583407 4:8078414-8078436 TCTGCTGGAGGGGCAGGCCCAGG - Intronic
969603665 4:8191185-8191207 TCAGCAGGTCAGGCAGACCCAGG + Intronic
970199438 4:13588074-13588096 GCTGCTTGTGAGGCTGAGGCAGG + Intronic
970423878 4:15929094-15929116 TCTGCCGGGGAGGCAGCCCCAGG - Intergenic
971542461 4:27836811-27836833 ACAGCTGATGAGACAGACCCTGG - Intergenic
971589254 4:28445943-28445965 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
971622418 4:28872595-28872617 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
971699407 4:29950128-29950150 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
971855965 4:32043993-32044015 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
971960712 4:33483409-33483431 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
972081232 4:35152914-35152936 GCTACTGGGGAGGCTGACACAGG - Intergenic
972096621 4:35354908-35354930 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
972234962 4:37121109-37121131 GATGCTGGTGAGTAAGACCGTGG - Intergenic
972386651 4:38573413-38573435 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
972404231 4:38731311-38731333 CCTGCTGGAGAGGGAGGCCCAGG + Intergenic
972583542 4:40416239-40416261 GCTGCTTGTGAGGCTGAGGCAGG + Intergenic
972632384 4:40853559-40853581 GCTGCTCGTGAGGCTGAGGCAGG - Intronic
973289680 4:48458214-48458236 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
973575694 4:52286614-52286636 GCTGCTTGGGAGGCTGATCCAGG + Intergenic
973640000 4:52893315-52893337 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
973674960 4:53254982-53255004 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
973767896 4:54180501-54180523 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
974327994 4:60440670-60440692 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
974460962 4:62187100-62187122 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
974626435 4:64432836-64432858 GCTGCAGTCGAGGCGGACCCTGG - Intergenic
975404584 4:73975440-73975462 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
975428063 4:74253840-74253862 GCTGGTGGTGAGGTAGACCTGGG - Intronic
975552504 4:75627822-75627844 GCTACTGGGGAGGCAGAAACAGG - Intronic
976204371 4:82610495-82610517 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
976206715 4:82629286-82629308 GCTGCTGGTGAGTGAGAATCAGG + Intergenic
976436824 4:85027865-85027887 GCTGCTCGTGAGGCTGAGGCAGG + Intergenic
976501649 4:85797282-85797304 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
976577140 4:86686248-86686270 GCTACTGGGGAGGCTGAGCCAGG + Intronic
976598145 4:86913670-86913692 GGTGCTGTTGTGGCTGACCCAGG + Intronic
976699846 4:87958153-87958175 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
976718932 4:88151625-88151647 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
976726371 4:88219691-88219713 GCTGCTGGGGAGGCTGAGACAGG - Intronic
976799969 4:88978680-88978702 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
976873395 4:89823905-89823927 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
977242081 4:94585200-94585222 GCTACTGGGGAGGCTGACGCAGG - Intronic
977305942 4:95323922-95323944 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
977517865 4:98044954-98044976 TCTCATGGTGAGGCAGACCTAGG - Intronic
978006425 4:103622615-103622637 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
978306129 4:107330458-107330480 TCTCCTGGGGAGGCAGACCATGG - Intergenic
979598271 4:122557933-122557955 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
979678981 4:123438966-123438988 GCTGCTGGGGAGGCCGAGACAGG - Intergenic
980078529 4:128319732-128319754 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
980129727 4:128807541-128807563 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
980237616 4:130129946-130129968 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
980680232 4:136151225-136151247 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
980752688 4:137112506-137112528 GCTGCTCAGGAGGCAGAGCCAGG - Intergenic
980937530 4:139240693-139240715 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
981049440 4:140295817-140295839 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
981093077 4:140753338-140753360 GCTGCTGGGGAGGCTGAGGCTGG - Intronic
981142319 4:141282840-141282862 GCTACTGGGGAGGCAGAGGCGGG + Intergenic
981315942 4:143339397-143339419 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
981778810 4:148401573-148401595 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982313844 4:154011255-154011277 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
982451629 4:155559649-155559671 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
982585434 4:157231148-157231170 GCTACTGGGGAGGCTGACGCAGG - Intronic
983109206 4:163727417-163727439 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
983154400 4:164328639-164328661 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
983193741 4:164782176-164782198 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
983531452 4:168813704-168813726 GCTACTGGTGAGGCTGAGGCAGG - Intronic
983548916 4:168994688-168994710 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
983770828 4:171547018-171547040 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
984130151 4:175864915-175864937 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
984201430 4:176725413-176725435 GCTGCTGAGGAGGCAGAGGCAGG - Intronic
984530025 4:180904648-180904670 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
984627594 4:182025138-182025160 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
985643308 5:1073773-1073795 GGTGCTGGTGATGCTGAACCTGG - Exonic
985815263 5:2123932-2123954 GCTGCTCGTGAGGCTCACACTGG + Intergenic
986066122 5:4236032-4236054 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
986156546 5:5182259-5182281 GCTGCTTTTGTGGCAGTCCCAGG - Exonic
986462022 5:7982402-7982424 ACTGCAGCTGAGGCTGACCCTGG + Intergenic
986745357 5:10739088-10739110 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
987508674 5:18807248-18807270 GCTGCTTGGGAGGCTGAGCCAGG - Intergenic
987791461 5:22574189-22574211 GCTACTCGTGAGGCTGACACAGG - Intronic
987896844 5:23957379-23957401 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
988048852 5:25997160-25997182 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
988620477 5:32817860-32817882 GCTACTCGGGAGGCTGACCCAGG - Intergenic
988983775 5:36597356-36597378 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
989231828 5:39095742-39095764 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
989464373 5:41737941-41737963 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
989499319 5:42147909-42147931 GCTGCTTGGGAGGCTGACGCAGG + Intergenic
990107136 5:52278526-52278548 GCTACTTGTGAGGCAGAGGCAGG + Intergenic
990285577 5:54297892-54297914 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
990423523 5:55661331-55661353 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
990761970 5:59139579-59139601 GCTACTTGGGAGGCAGAGCCTGG - Intronic
991084512 5:62636361-62636383 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
991288834 5:65011110-65011132 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
991771789 5:70047968-70047990 GCTGCTTGGGAGGCTGAGCCAGG - Intergenic
993387154 5:87273807-87273829 GCTACTGGGGAGGCAGAGGCAGG - Intronic
993891142 5:93475010-93475032 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
994138016 5:96309607-96309629 TCTGCTGGTTAGGAAGACCATGG + Intergenic
994448589 5:99909936-99909958 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
994625704 5:102215748-102215770 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
994626324 5:102224669-102224691 GCTATTGGTGAGGCAGAGGCAGG + Intergenic
995317187 5:110788743-110788765 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
995792219 5:115901664-115901686 GCTACTCGGGAGGCTGACCCAGG - Intronic
995876138 5:116792264-116792286 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
996736538 5:126763790-126763812 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
996855584 5:128002631-128002653 GCAGCTGGTGAAGCACAACCTGG - Intergenic
997145775 5:131431734-131431756 GCTGCTGGGGAGGCTGAGGCGGG - Intronic
997165617 5:131657927-131657949 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
997322812 5:132992866-132992888 GCTACTGGGGAGGCTGACGCAGG - Intergenic
997332766 5:133078218-133078240 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
997552611 5:134766607-134766629 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
997589533 5:135064307-135064329 GCTGTTGGTGGGGCAGACATGGG + Intronic
997643737 5:135466735-135466757 GCTGCTGCTACGGCAGGCCCTGG - Intergenic
998119841 5:139567209-139567231 GCTGCTCGGGAGGCTGACGCAGG - Intronic
998273709 5:140731559-140731581 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
998978665 5:147676222-147676244 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
999063896 5:148664363-148664385 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
999298544 5:150475945-150475967 GCTGCTGGGGAGGCTGAGACAGG - Intergenic
999539671 5:152557729-152557751 CCTGGTGCTGAGGCAGAGCCTGG - Intergenic
999991752 5:157056489-157056511 GCTGCTGGGGAGGCTGAGGCGGG - Intronic
1000001699 5:157144570-157144592 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1000466673 5:161587344-161587366 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1000742636 5:164988312-164988334 GCTACTCGGGAGGCAGAACCAGG + Intergenic
1000854908 5:166385944-166385966 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1000995927 5:167959304-167959326 GCTGCTGGGGAGGCTGAGTCAGG - Intronic
1001384467 5:171327113-171327135 GCTGCTTGGGAGGCAGAGGCAGG + Intergenic
1001393169 5:171396859-171396881 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1001496722 5:172193074-172193096 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1001773406 5:174312003-174312025 GCAGCTCAGGAGGCAGACCCGGG + Intergenic
1001895891 5:175380505-175380527 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1001947320 5:175790672-175790694 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1002509846 5:179707470-179707492 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1002824516 6:761016-761038 GCTGCTGGGGAGGCTGAGGCCGG + Intergenic
1003531263 6:6939538-6939560 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1003547921 6:7076323-7076345 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1003761877 6:9188019-9188041 GATGATGTGGAGGCAGACCCAGG - Intergenic
1003871782 6:10410026-10410048 ACAGCTGGTGAGGCAGCCCCCGG + Exonic
1004121725 6:12829844-12829866 GCTGCTGGGGAGGCAGAGACAGG + Intronic
1004545848 6:16597548-16597570 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1005071117 6:21862897-21862919 GCTGCTTGGGAGGCTGACGCAGG + Intergenic
1005212684 6:23486122-23486144 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1005740954 6:28790011-28790033 GCTACTGGGGAGGCTGAGCCAGG + Intergenic
1005966273 6:30728891-30728913 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1006098551 6:31671307-31671329 GCTGCTGGTGGGGCAGCCAATGG + Intronic
1006111887 6:31751985-31752007 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1006175703 6:32120207-32120229 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1006196941 6:32249732-32249754 GCTGCTGGGGAGGCTGAGCTGGG - Intergenic
1006344859 6:33472601-33472623 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1006431527 6:34000287-34000309 CCTCCTGTTGAGGCAGAGCCTGG + Intergenic
1006443881 6:34068226-34068248 GCAGCTGGAGAGGCAGAGGCTGG + Intronic
1006708668 6:36045695-36045717 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1006843164 6:37044047-37044069 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG + Intergenic
1006952695 6:37837614-37837636 GCTGCTCGGGAGGCTGACGCAGG - Intronic
1007415274 6:41687948-41687970 GCTGCTGGTGACGCCCACCAGGG + Exonic
1007453322 6:41956917-41956939 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1007468535 6:42072832-42072854 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1007751532 6:44074486-44074508 GCTGCTGGAGAGGTAAGCCCAGG - Intergenic
1007768979 6:44178334-44178356 ACTGCTGGTGGGGCAGACAAGGG - Intronic
1007906960 6:45471554-45471576 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1008176331 6:48271637-48271659 GGTGCTGGTCAGGCACACCAGGG + Intergenic
1008807811 6:55453288-55453310 GCTGCTGGTAAGGCTGAGGCAGG - Intronic
1009434674 6:63604055-63604077 GCTACTGGGGAGGCTGAGCCAGG + Intergenic
1009446804 6:63752602-63752624 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1009609551 6:65923069-65923091 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1010029600 6:71259403-71259425 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1010222888 6:73462909-73462931 GCTACTGGTTAGGCAGAGGCAGG - Intronic
1010884983 6:81225525-81225547 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1010969608 6:82249080-82249102 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1011015383 6:82748829-82748851 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1011047452 6:83101125-83101147 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1011102176 6:83735147-83735169 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1011639431 6:89405240-89405262 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1012394496 6:98780733-98780755 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1013106317 6:107029135-107029157 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1013209189 6:107971740-107971762 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1013223769 6:108104412-108104434 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1013264159 6:108478323-108478345 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1013748205 6:113370083-113370105 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
1013931373 6:115537979-115538001 AATGCTGGTGAAGCAGACCGAGG - Intergenic
1014594848 6:123322750-123322772 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1015313438 6:131790960-131790982 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1015450705 6:133363584-133363606 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1015569027 6:134602953-134602975 TCTCCTGGGGAGGCAGACCATGG + Intergenic
1015574505 6:134656921-134656943 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1015953983 6:138581578-138581600 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1016002509 6:139056644-139056666 GCTACTGGGGAGGCTGAGCCAGG + Intergenic
1016044278 6:139465335-139465357 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1016269116 6:142268306-142268328 GCTACTCGGGAGGCAGAGCCAGG - Intergenic
1016424930 6:143925285-143925307 GCTGCTCGGGAGGCTGACGCAGG - Intronic
1016612754 6:146011030-146011052 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1016886800 6:148966846-148966868 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1016978010 6:149827908-149827930 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1017148953 6:151260878-151260900 GCTGCTCGGGAGGCTGACACAGG + Intronic
1017424859 6:154309873-154309895 GCTACTTGGGAGGCTGACCCAGG - Intronic
1017436673 6:154422102-154422124 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1017557976 6:155593361-155593383 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1017757837 6:157544535-157544557 GCTACTGGGGAGGCTGACGCAGG + Intronic
1017879009 6:158546846-158546868 GCTGCTTGTGAGGCTGAGGCCGG + Intronic
1018861181 6:167712034-167712056 GCTTCTGGTGAGGCCTACCCTGG - Intergenic
1019177539 6:170167867-170167889 GCTGCTTTTGACACAGACCCAGG + Intergenic
1019320260 7:411928-411950 GCGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1019422345 7:956868-956890 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1019680208 7:2343561-2343583 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1019723703 7:2588775-2588797 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1020138712 7:5600601-5600623 GCTGCTCGGGAGGCTGACGCAGG - Intronic
1020421528 7:8011925-8011947 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1021456599 7:20835852-20835874 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1021893446 7:25210723-25210745 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1022075640 7:26967066-26967088 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1022408673 7:30118687-30118709 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1022587520 7:31628567-31628589 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1022722338 7:32952566-32952588 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1022758681 7:33323947-33323969 GCTGCTCGAGAGGCTGACGCAGG - Intronic
1023211579 7:37811095-37811117 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1023217696 7:37882373-37882395 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1023222519 7:37934086-37934108 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1023403962 7:39812042-39812064 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1023426278 7:40040121-40040143 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1023489588 7:40724449-40724471 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1023768244 7:43531874-43531896 GCAGATGGAGAGGCGGACCCAGG - Intronic
1023973500 7:45009514-45009536 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1024058666 7:45682471-45682493 GCTGCAGGTGGGGCAGGCCGAGG + Intronic
1024254115 7:47527123-47527145 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1024298006 7:47861767-47861789 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1024325220 7:48104104-48104126 GCTGCTGGTGAGGCTGAGGCAGG + Intronic
1024376646 7:48646629-48646651 GCTGCTGGGGAGGCTGAGGCAGG - Exonic
1024542076 7:50483790-50483812 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1025140191 7:56456499-56456521 GCTGCTTGGGAGGCTGAACCAGG + Intergenic
1025217635 7:57071780-57071802 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1025628548 7:63245420-63245442 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1025653716 7:63498682-63498704 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1025779417 7:64586798-64586820 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1025977951 7:66384513-66384535 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1026059260 7:67011549-67011571 GCTCCTGGTGATGCTGACACAGG + Intronic
1026264360 7:68783426-68783448 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1026320827 7:69266318-69266340 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1026453130 7:70546665-70546687 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1026461499 7:70619102-70619124 TCTGCTGGAAAGGGAGACCCAGG - Intronic
1026625210 7:71986157-71986179 GCTGCTCGGGAGGCTGACGCAGG - Intronic
1026718834 7:72813498-72813520 GCTCCTGGTGATGCTGACGCAGG - Intronic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1027175066 7:75898061-75898083 GCTGCTGGGGAGGCTGAGACAGG + Intergenic
1027203530 7:76079178-76079200 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1027236505 7:76301632-76301654 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1027535235 7:79391793-79391815 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1027657168 7:80945008-80945030 GCTGCTCGTGAGGCTGAGGCAGG - Intergenic
1027666223 7:81045109-81045131 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1028002612 7:85519075-85519097 GCTACTGGGGAGGCTGACGCAGG - Intergenic
1028320540 7:89454389-89454411 GCTACTGGGGAGGCAGAGGCAGG - Intergenic
1028541778 7:91950339-91950361 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1028640663 7:93039344-93039366 GCAGCTGGGGCTGCAGACCCAGG + Intergenic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029085776 7:98010575-98010597 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1029096811 7:98091792-98091814 GCTGCTTGGGAGGCTGACGCAGG - Intergenic
1029193730 7:98789829-98789851 GCTGCTTGTGAGGCTGAGGCAGG - Intergenic
1029229914 7:99058239-99058261 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1029399056 7:100331093-100331115 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1029413800 7:100430813-100430835 GCTGCTGGTGGTGCTGTCCCCGG - Exonic
1029420954 7:100471626-100471648 GCTACTGGGGAGGCTGAGCCAGG + Intronic
1029643966 7:101839871-101839893 GCTACTGGGGAGGCTGAGCCAGG - Intronic
1029697576 7:102224316-102224338 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1029733189 7:102451087-102451109 GCTGCTCGGGAGGCAGAGGCAGG + Exonic
1029795822 7:102893654-102893676 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1030047361 7:105509580-105509602 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1030204808 7:106942490-106942512 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1030293808 7:107898700-107898722 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1030532745 7:110730634-110730656 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1031276668 7:119732714-119732736 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1031802010 7:126258748-126258770 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1032036688 7:128526751-128526773 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1032040536 7:128557073-128557095 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1032540566 7:132699601-132699623 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1033301472 7:140189957-140189979 GGGGCTGGAGAGTCAGACCCAGG + Intergenic
1033596021 7:142858545-142858567 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1033602849 7:142900907-142900929 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1033649953 7:143333187-143333209 GCTACTGGGGAGGCTGACGCAGG + Intronic
1033881408 7:145887782-145887804 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1034178739 7:149121501-149121523 GCTGCTCGTGAGGCTGAGGCAGG - Intronic
1034422400 7:150996496-150996518 GCAGCTGCTGAGTCAGGCCCGGG + Exonic
1034476590 7:151287893-151287915 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1035276393 7:157750514-157750536 GCTGCTGGAGACCCAGCCCCAGG + Intronic
1035299577 7:157888075-157888097 GTTTCTGGAGAGACAGACCCTGG + Intronic
1035424577 7:158760565-158760587 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1035595385 8:853621-853643 GCTGCTTGCGAGGCTGGCCCTGG - Intergenic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1035770751 8:2144952-2144974 CCTGCCGCTGAGGCAGACGCGGG - Exonic
1036021198 8:4848649-4848671 GCTACTCGAGAGGCAGAGCCAGG - Intronic
1036431376 8:8694395-8694417 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1036556140 8:9862130-9862152 TCTGCGGCTGAGGCAAACCCTGG - Intergenic
1036668359 8:10763201-10763223 GCTGCTGGGGAGGCTGAGACAGG + Intronic
1037317876 8:17616304-17616326 GCTACTGGGGAGGCTGACGCAGG - Intronic
1037925297 8:22839415-22839437 GCTGGTGGGGAGGCAGAGGCTGG + Intronic
1037958501 8:23077540-23077562 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1037966734 8:23140175-23140197 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1038571730 8:28668441-28668463 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1038583018 8:28766451-28766473 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1038717328 8:30003735-30003757 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1038829780 8:31044151-31044173 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1038986761 8:32819960-32819982 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1039056836 8:33543726-33543748 GCTACTGGGGAGGCTGACGCAGG - Intergenic
1039225510 8:35384102-35384124 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1039450724 8:37672912-37672934 GCTACTGGGGAGGCTGACACAGG + Intergenic
1039605157 8:38874495-38874517 GCTGCTTGTGACGCAGGCGCAGG + Intergenic
1039688611 8:39837496-39837518 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1039764234 8:40611450-40611472 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1039804935 8:40989731-40989753 GCTGCTGGTCAGGGCGGCCCAGG - Intergenic
1039911850 8:41832628-41832650 TCTTCTTGTGAGGCAGACACTGG + Intronic
1040601140 8:48884752-48884774 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1040769845 8:50960471-50960493 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1040773509 8:51010349-51010371 GCTACTTGAGAGGCTGACCCAGG - Intergenic
1040798744 8:51317833-51317855 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1041356427 8:57005616-57005638 GCTGCTGGTGGTGCACTCCCTGG + Intergenic
1041359283 8:57033973-57033995 TCTGCTGCTGAGGCAGCCCCTGG + Intergenic
1041709777 8:60883987-60884009 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1041937631 8:63351405-63351427 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1042144471 8:65713793-65713815 GCTACTGGAGAGGCAGAGGCAGG - Intronic
1042238471 8:66639094-66639116 GCTACTGGTGAGGCTGACGTGGG - Intronic
1042279038 8:67035460-67035482 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1042295395 8:67212192-67212214 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1042313674 8:67402669-67402691 GCTACTGGTGAGGCTGAGACAGG - Intergenic
1042561431 8:70074668-70074690 GCTCCTGGGGAGGCTGACACAGG - Intergenic
1042706275 8:71667837-71667859 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1042991198 8:74641960-74641982 GCTGCTGGTGAGGCAGTACAGGG + Intronic
1043076739 8:75710746-75710768 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1043382552 8:79719376-79719398 GCTGCTGGGGAGGCTGACGCGGG - Intergenic
1043579249 8:81692611-81692633 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1044592773 8:93930101-93930123 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1044706096 8:95010198-95010220 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1044806888 8:96017442-96017464 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1044930811 8:97249830-97249852 GCTGCTTGAGACGCAGAGCCAGG - Intergenic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1045265451 8:100614923-100614945 GCTGTGGGTGAGGCAAACCTGGG + Intronic
1045855111 8:106756262-106756284 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1046144110 8:110134647-110134669 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1046161321 8:110369342-110369364 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1046227572 8:111305319-111305341 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1046267501 8:111849282-111849304 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1046407729 8:113796596-113796618 GTTGCTGGTAATGCAAACCCTGG + Intergenic
1047108406 8:121760643-121760665 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1047132768 8:122039544-122039566 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1047580325 8:126207034-126207056 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1047774702 8:128060142-128060164 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1048024948 8:130577819-130577841 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1048418381 8:134251898-134251920 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1049110593 8:140640118-140640140 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1049312147 8:141938906-141938928 GCTGCTTCTGAGACAGCCCCTGG - Intergenic
1049315093 8:141961752-141961774 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1049378769 8:142301740-142301762 GCTCCTGGTGAGGCCGGTCCTGG - Intronic
1049438274 8:142597656-142597678 ACTGCTGGGGAGACGGACCCAGG + Intergenic
1049573204 8:143379072-143379094 GCCGCTGGTGAGGGCGGCCCGGG + Exonic
1049878752 8:145046562-145046584 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1050521374 9:6504135-6504157 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1050814190 9:9788438-9788460 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1050910301 9:11059842-11059864 GCTGCTTGGGAGGCAGAGTCAGG - Intergenic
1051158258 9:14175283-14175305 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1051186040 9:14462392-14462414 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1051292012 9:15554129-15554151 GCTGCTGGGGAGGCTGAGACAGG - Intronic
1051631329 9:19143764-19143786 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1052022844 9:23544470-23544492 GCTGCTGGGGAGGCTGAGGCTGG + Intergenic
1052033062 9:23650346-23650368 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1052287253 9:26800210-26800232 GCTGATGGAGAGGCTGACACTGG + Intergenic
1052424358 9:28285515-28285537 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1052482568 9:29050135-29050157 GCTACTGGTGAGGCTGAGGCGGG - Intergenic
1052825443 9:33170783-33170805 GGTGCTAGTGAGACAGACCCAGG + Intergenic
1053013190 9:34647015-34647037 CCTGCTGGTGGGTGAGACCCAGG + Intronic
1053070056 9:35095890-35095912 GCTACTGGGGAGGCTGACGCAGG + Intronic
1053130373 9:35611137-35611159 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1053332770 9:37231053-37231075 ACTGCTGGGGAGGCTGACGCAGG - Intronic
1053541766 9:38981003-38981025 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1053571616 9:39315598-39315620 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1053621595 9:39825085-39825107 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1054093173 9:60874299-60874321 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1054114651 9:61150212-61150234 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1054125529 9:61303414-61303436 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1054593103 9:67032313-67032335 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1054624373 9:67382907-67382929 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1054743212 9:68828988-68829010 GCTGCTTGGGAGGCTGACACAGG + Intronic
1054799785 9:69335677-69335699 GCATCTGATGAGGCTGACCCTGG + Intronic
1054799809 9:69335870-69335892 GCTACTGGAGAGGCAGAGGCGGG + Intronic
1055095883 9:72413914-72413936 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1055146291 9:72938852-72938874 GCTACTGGGGAGGCTGACGCAGG - Intronic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1055761871 9:79617611-79617633 GCTGGAGGTCAGCCAGACCCAGG + Intronic
1056315223 9:85382079-85382101 ACTGCTGGTGAGGATGCCCCTGG + Intergenic
1056643951 9:88393957-88393979 GCTGCTTGGGAGGCTGAGCCAGG - Intronic
1056794709 9:89649800-89649822 GCTGTGGCTGAGGGAGACCCTGG + Intergenic
1057211729 9:93204285-93204307 TCTGCTGGGGAGGCAGACGAGGG + Intronic
1057261223 9:93585932-93585954 CCTGCTGGTGAGGTGGAACCTGG - Intronic
1057315782 9:93967382-93967404 TGTGCAGGTGAGGCCGACCCAGG + Intergenic
1057347023 9:94260021-94260043 GCTGCTCGGGAGGCTGACGCGGG - Intronic
1057474212 9:95384934-95384956 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1057548065 9:96032668-96032690 GCTCCTGGTGAGGCAGCAACTGG - Intergenic
1057761321 9:97876910-97876932 GTGGCTGGTGAGATAGACCCAGG - Intergenic
1057961188 9:99458821-99458843 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1058007032 9:99927584-99927606 GCTACTTGTGAGGCAGAGGCAGG - Intronic
1058249393 9:102672451-102672473 GCTGCTCGGGAGGCTGACCCAGG - Intergenic
1058279064 9:103088234-103088256 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1058586159 9:106508138-106508160 GCTACTGGGGAGGCTGAGCCAGG - Intergenic
1058693292 9:107537346-107537368 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1059317036 9:113434695-113434717 GCTGCTTGGGAGGCTGACGCAGG - Intergenic
1059394882 9:114028066-114028088 ACTGCTGGAGAGCCAGCCCCCGG + Intronic
1060050104 9:120372340-120372362 GCTTCTTGTCAGGAAGACCCAGG + Intergenic
1060482521 9:124025327-124025349 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1060486323 9:124049674-124049696 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1060543331 9:124446506-124446528 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1060658890 9:125391257-125391279 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1060800664 9:126543436-126543458 GCTGCTCGGGAGGCTGAACCAGG + Intergenic
1060810554 9:126609624-126609646 TTTGCTGGTGAGGCAGAGCTGGG - Intergenic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061107807 9:128545407-128545429 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1061116522 9:128616653-128616675 GCTGCTTGTGAGGCTGAGGCAGG + Intronic
1061162689 9:128904404-128904426 GCTGCTTGGGAGGCAGAGGCAGG + Intronic
1061173544 9:128977229-128977251 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1061232818 9:129324791-129324813 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1061295621 9:129675359-129675381 GATGCTGGTGAGGGAGAGACAGG - Intronic
1061639245 9:131938823-131938845 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1061707287 9:132462916-132462938 GGTGCTGGAGAGACAGACCCAGG - Intronic
1061747661 9:132752359-132752381 GCTGCTCGGGAGGCAGAGGCAGG - Intronic
1061829922 9:133285173-133285195 GCTACTGGGGAGGCAGAGGCAGG + Intergenic
1061963693 9:134001341-134001363 CATGCTGGTGGGGCAGAACCAGG - Intergenic
1062207476 9:135345114-135345136 GCTGCTGGTGAGAAAGACGGCGG + Intronic
1062222939 9:135428519-135428541 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062362063 9:136192990-136193012 GCGGCGGGTGAGGCAGGGCCGGG - Intergenic
1062370568 9:136236727-136236749 GCTCCAGGTGACGCAGACCCAGG - Intronic
1062370750 9:136237408-136237430 GCTCCAGGTGATGCAGGCCCAGG - Intronic
1062380142 9:136283135-136283157 GCTGCTGGGGAGGCTGAGGCGGG + Intronic
1062458076 9:136649712-136649734 GCTGCTTGTGAGGCTGAGGCAGG - Intergenic
1203731538 Un_GL000216v2:95964-95986 GCTGCTCGGGAGGCTGAGCCAGG - Intergenic
1185470707 X:381037-381059 GCTGCTTGTGAGGCTGAGGCAGG - Intronic
1185557326 X:1031722-1031744 GCTGCTGGTGGACCAGGCCCAGG - Intergenic
1185678332 X:1866899-1866921 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1185752506 X:2625079-2625101 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1186792136 X:13009743-13009765 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1187012793 X:15297178-15297200 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1187149106 X:16665860-16665882 GCTGCTAGGGAGGCTGACACAGG - Intronic
1187238397 X:17489597-17489619 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1187269762 X:17769100-17769122 GCTGCAGGTGAAGCAGCCACTGG - Intergenic
1187929611 X:24281826-24281848 GCTGCTTGGGAGGCTGAGCCAGG - Intergenic
1187960717 X:24564068-24564090 GCTTCTGGGGAGGCTGACGCAGG + Intronic
1188282399 X:28286333-28286355 GCTGCTTGAGAGGCAGAGGCAGG + Intergenic
1188302804 X:28526409-28526431 GCTACTGGTGAGGCTGAGGCAGG - Intergenic
1188307384 X:28574630-28574652 GCTGCTTGGGAGGCAGAGGCAGG + Intergenic
1188471759 X:30548323-30548345 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1188516223 X:30989519-30989541 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1188874332 X:35411393-35411415 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1189284697 X:39843395-39843417 GTTGCCGGTGAGGAAGAGCCAGG - Intergenic
1189646139 X:43134721-43134743 GCTACTGGTGAGGCTGAGTCAGG - Intergenic
1190017800 X:46843117-46843139 GCTGCTGGGGAGGCCGAGACAGG - Intronic
1190331522 X:49238670-49238692 GCTACTAGTGAGGCAGAGGCAGG - Intronic
1190740427 X:53284847-53284869 GCTGTTGGCCAGGCCGACCCAGG + Intronic
1191054804 X:56231127-56231149 GCTGCTTGAGAGGCAGACAAAGG + Intergenic
1192733094 X:73820426-73820448 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1192838140 X:74824758-74824780 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1193376156 X:80764415-80764437 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1193439377 X:81519737-81519759 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1193442909 X:81565144-81565166 GCTGTGGGTAAGCCAGACCCAGG + Intergenic
1193778019 X:85667950-85667972 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1194033789 X:88846446-88846468 TCTCCTGGGGAGGCAGACCATGG + Intergenic
1194480176 X:94412360-94412382 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1194745469 X:97623356-97623378 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1195271939 X:103240893-103240915 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1195569219 X:106380364-106380386 GCTGCTAGAGAGGCAACCCCTGG - Intergenic
1195784829 X:108507694-108507716 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1195798021 X:108673928-108673950 GCTGCTCGGGAGGCTGAGCCAGG + Intronic
1196602683 X:117620552-117620574 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1196809853 X:119620428-119620450 GCTGCTGGGGAGGCTGAGGCAGG - Intronic
1196829708 X:119766494-119766516 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1197219391 X:123897041-123897063 GCTACTGGGGAGGCAGAGGCAGG - Intronic
1197382306 X:125760138-125760160 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1197512586 X:127389651-127389673 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1197646937 X:129027876-129027898 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1197765105 X:130055151-130055173 GGTGCTGGAGAGGCCGATCCCGG - Intronic
1197878933 X:131144009-131144031 GCTACTGGTGAGGCTGAGGCAGG + Intergenic
1198247993 X:134849982-134850004 GCTACTGGTGAGGCTGAGGCAGG - Intronic
1198448489 X:136742205-136742227 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1199123840 X:144090636-144090658 GCTACTGGGGAGGCTGACGCAGG + Intergenic
1199259941 X:145760578-145760600 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1199388929 X:147256463-147256485 GCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1199457142 X:148042177-148042199 GCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1200066949 X:153508505-153508527 CCTGATGGGGAGGCAGAGCCAGG + Exonic
1200616241 Y:5383090-5383112 GCTGCTGGGGAGGCTGAGGCAGG + Intronic
1200847492 Y:7846048-7846070 GCTACTTGGGAGGCTGACCCAGG + Intergenic
1202025719 Y:20520636-20520658 GCTACTGGGGAGGCTGAGCCAGG - Intergenic