ID: 1078466164

View in Genome Browser
Species Human (GRCh38)
Location 11:11552163-11552185
Sequence CTGCATTTCCAGAGGGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078466164_1078466170 -3 Left 1078466164 11:11552163-11552185 CCATAGGCCCTCTGGAAATGCAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1078466170 11:11552183-11552205 CAGGTCTTCAACAAGAGGCAGGG 0: 1
1: 0
2: 3
3: 15
4: 182
1078466164_1078466168 -8 Left 1078466164 11:11552163-11552185 CCATAGGCCCTCTGGAAATGCAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1078466168 11:11552178-11552200 AAATGCAGGTCTTCAACAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 185
1078466164_1078466169 -4 Left 1078466164 11:11552163-11552185 CCATAGGCCCTCTGGAAATGCAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1078466169 11:11552182-11552204 GCAGGTCTTCAACAAGAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1078466164_1078466171 5 Left 1078466164 11:11552163-11552185 CCATAGGCCCTCTGGAAATGCAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1078466171 11:11552191-11552213 CAACAAGAGGCAGGGTTTCCAGG 0: 1
1: 0
2: 2
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078466164 Original CRISPR CTGCATTTCCAGAGGGCCTA TGG (reversed) Intronic
900309849 1:2028434-2028456 CTGCATCCCCAGAGGCCCTGGGG - Intronic
901508843 1:9704274-9704296 CTTCATTTCCAGAGTGCTAAGGG + Intronic
902203552 1:14851472-14851494 TTGCATGTGCAGAGGGCCCATGG + Intronic
903010160 1:20324169-20324191 CTGTTTTTCCAGATGGCCAAGGG - Intronic
903701037 1:25248068-25248090 CTGCATTTCCAGGGGTCTTGGGG - Intronic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
905273672 1:36803258-36803280 CAGCATGTGCAAAGGGCCTAAGG + Intronic
910046215 1:82920412-82920434 TTGCATTTCCAAAGGGCCTTTGG + Intergenic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
910783427 1:90967206-90967228 CTACATGTACAGAGGCCCTATGG - Intronic
913241514 1:116834262-116834284 CTGCATTTCCAGCCGCCCTGTGG - Intergenic
914456694 1:147843215-147843237 CTGCATCTGTTGAGGGCCTAAGG + Intergenic
915681170 1:157583272-157583294 CTGAATTTCCTGAGAGTCTAGGG - Intronic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916705280 1:167342936-167342958 AAGCATTTCCAGAGAGCCTCAGG + Intronic
916714723 1:167439307-167439329 CTTCCTTTCCGGAGGGTCTACGG + Intronic
918674599 1:187267253-187267275 CTGCACATTCTGAGGGCCTAAGG + Intergenic
923911595 1:238452353-238452375 GTCCATTTCCAGTGGGGCTAAGG - Intergenic
923920263 1:238556203-238556225 CTGCATTTGGTGAGGGCCTCAGG + Intergenic
1063845654 10:10124355-10124377 CTGCATATCCAGCAGGTCTAGGG + Intergenic
1063904411 10:10767432-10767454 CTCCATTTCCTGAGGGACTTAGG - Intergenic
1065815740 10:29480964-29480986 CTGCATTTCCAGAAAGACTCTGG + Intronic
1068930232 10:62581887-62581909 CAGCATTTCCAGAGGCACTGAGG - Intronic
1069266379 10:66463377-66463399 CTGCATTTGGTGAGGGCCTCAGG - Intronic
1069362569 10:67659751-67659773 CTGCAAGTCCAGTGAGCCTATGG + Intronic
1069833121 10:71293258-71293280 CTGCATTCCCAGAGGTCATGGGG - Intronic
1070507305 10:77125419-77125441 CTGCATGTGCAGAGGCCCTGGGG - Intronic
1070820697 10:79352405-79352427 CCGCATTCCCAGAGGGCCTGGGG - Intronic
1072249696 10:93571990-93572012 CAGCATTTCCACAGTGCCTGTGG + Intronic
1073727246 10:106247694-106247716 CTTCATACCCACAGGGCCTAGGG + Intergenic
1074153126 10:110776163-110776185 CTACATTCCCAGAGGGTCTTTGG + Intronic
1075210132 10:120483857-120483879 CTGCATCTGCTGAGGGCCTCAGG - Intronic
1075326126 10:121533509-121533531 CTGCATTTCCAGAGACCCTCAGG - Intronic
1076124488 10:127963114-127963136 CTGCATTTCCATAGGCCCCAGGG - Intronic
1076711266 10:132336104-132336126 CTGCATTTCCAGAGGTGCTGGGG + Intronic
1078466164 11:11552163-11552185 CTGCATTTCCAGAGGGCCTATGG - Intronic
1079398271 11:20084686-20084708 CTCCATCTGCAGAGTGCCTAAGG + Intronic
1083720550 11:64601633-64601655 CTCCATTTCCAGAGGCCCAGAGG + Exonic
1084040997 11:66542705-66542727 CTTGATTTCCACAGGGCCCAGGG + Intronic
1085431773 11:76457704-76457726 CTGCATGGCCAGAGGTTCTAAGG - Intronic
1086303932 11:85459733-85459755 CTGCAATTCCAGAGGGGTTGTGG + Intronic
1087387851 11:97495294-97495316 CTTCTTTTCCAGACTGCCTATGG - Intergenic
1088968822 11:114753156-114753178 CTGCACTTTCAGAGGCCCTTGGG + Intergenic
1094523112 12:31214073-31214095 CTGAAAATCCACAGGGCCTAGGG + Intergenic
1097946056 12:65368806-65368828 TTGCATATTTAGAGGGCCTAGGG + Intronic
1098961696 12:76745743-76745765 CTGCATATGCTGAGGGCCTCAGG - Intergenic
1100046213 12:90383652-90383674 GTGCACTCCCAAAGGGCCTAAGG + Intergenic
1101452883 12:104796427-104796449 ATTCATTTCCATATGGCCTATGG - Intergenic
1101718254 12:107330099-107330121 CTGCATGTGCAAAGGGCCTGTGG + Intronic
1103748117 12:123140158-123140180 CTGCGTTCCCCGGGGGCCTAAGG - Intronic
1106326128 13:28692239-28692261 CTGCATTTCAAGAGCTCCTGAGG - Intergenic
1107453797 13:40536165-40536187 CTGAATATGCAGAGGGCTTAAGG + Intergenic
1110089294 13:71424885-71424907 CTCCTTCTCCAGAGGGTCTATGG + Intergenic
1111312854 13:86512589-86512611 GTGAATCTTCAGAGGGCCTAGGG - Intergenic
1115517156 14:34197396-34197418 CTGCCTTTCCATATGGCTTAAGG + Intronic
1116394726 14:44433756-44433778 CTAAATTTCCAGAGAGCCTAGGG - Intergenic
1117672400 14:58122382-58122404 CTGCCTTTCTAGAGAGACTAAGG + Intronic
1118134121 14:63002784-63002806 CTGCAACCCCAGGGGGCCTATGG + Intronic
1119826148 14:77658768-77658790 CTACGTTGCCAAAGGGCCTATGG - Intergenic
1120415798 14:84216768-84216790 CTGCACATCCAGAGTGCCTGGGG + Intergenic
1122372207 14:101234938-101234960 CTGCATTCCGAGAGGGCATTTGG + Intergenic
1122579364 14:102762027-102762049 GCCCATTTCCAGAGGGCCTGAGG + Intergenic
1122610552 14:102979613-102979635 ATTCATTTCCAGAGGTCCTGGGG + Intronic
1122761660 14:104033255-104033277 CTGCATTTTCACAAGGCCTCTGG + Intronic
1124368378 15:29089654-29089676 TTCCCTCTCCAGAGGGCCTAGGG + Intronic
1126096841 15:45096027-45096049 CTGCAATTCCAGAGGCCCCAAGG - Exonic
1127954586 15:63842108-63842130 CTGCATTTCCTGATTGCCTTGGG + Intergenic
1128901359 15:71425487-71425509 CTGCAGCTCCACAGCGCCTATGG + Intronic
1129302459 15:74633300-74633322 CTGCCTTCCCAGAGGTCATAAGG - Intronic
1130037768 15:80377237-80377259 CTGCATGGCTAGAGGGCCTCAGG + Exonic
1130980788 15:88810575-88810597 CTGCATATCCAGATGGCTCAGGG + Intronic
1131551519 15:93361183-93361205 GCGCATTTCCAGAGGGACCAGGG + Intergenic
1133100798 16:3478416-3478438 CTGCAGTTCTCGTGGGCCTAAGG + Intronic
1134022971 16:10934153-10934175 CTGCCCTTCCAGAGGGCTCAGGG - Intronic
1134353978 16:13463858-13463880 CTGCAATTCCAGGGAGCCAACGG - Intergenic
1135762246 16:25146770-25146792 GTGCATTTCCCAAGGGCCTCAGG + Intronic
1136270153 16:29143775-29143797 CAGCATTTTCAAAGGGCCCAGGG + Intergenic
1139238780 16:65368932-65368954 GTGACTTTCCAGAGGGCCAAAGG + Intergenic
1140969695 16:80001125-80001147 CTGCATTTTCACAGGACCTGTGG + Intergenic
1142073746 16:88105609-88105631 CAGCATTTTCAAAGGGCCCAGGG + Intronic
1142950448 17:3474356-3474378 CAGCATTTCCAGAGAGACTAGGG + Intronic
1143979267 17:10854283-10854305 CTGCATCTGCGGAGGGCCTCAGG + Intergenic
1145105951 17:20117040-20117062 CTTCAGTTCCAGAATGCCTAAGG - Intronic
1145270225 17:21400952-21400974 CTGCATTGCTATAGGGCCTGGGG + Intronic
1148996360 17:51713706-51713728 CTGCATTTCCATATGGCCCTGGG + Intronic
1150135391 17:62692528-62692550 CTGCCTGTCCAGTTGGCCTATGG + Exonic
1151417907 17:73978622-73978644 CAGCTTTTCCTGTGGGCCTATGG - Intergenic
1151854278 17:76710457-76710479 CTGCATTTCCTGCGGGCCGCGGG + Intronic
1153269451 18:3305519-3305541 CTGCATTTATTCAGGGCCTAGGG + Intergenic
1157973582 18:52299510-52299532 CTCCATTTCCATGGGGCCCATGG - Intergenic
1157985594 18:52434650-52434672 TTGCATTTCCAAAGGGTCTCTGG - Intronic
1160462384 18:79048792-79048814 CTGCATTTCCTCAGAGCCCAGGG + Intergenic
1160722143 19:602441-602463 CTGCATTTCCAGAGGAAGTGGGG - Intronic
1160733468 19:651488-651510 CGGCCTCTCCAGAGAGCCTATGG + Intronic
1160806659 19:995015-995037 CTGCGTTTCCACAGGGACCAGGG - Intronic
1162309792 19:9899407-9899429 CTGCATGTGCAGAGGCCCTGAGG - Intronic
1164269583 19:23659784-23659806 CTGCTTTTCCAGAGGCCCAGAGG + Intronic
1164461746 19:28454884-28454906 TTGCATTTCCAGAGGGCCCTGGG + Intergenic
1166886095 19:45961896-45961918 GTGCTCTTCCAGAGGGACTAAGG + Intronic
1167126914 19:47555779-47555801 CTTCATTTTCAGAGAGCCAAGGG - Exonic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
927344042 2:22015882-22015904 GTGCATTTCCTGAGAGCCTCAGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928119870 2:28576106-28576128 TTGCATTTCCAGAGGCCTTGGGG + Intronic
928386424 2:30872310-30872332 TTGCATTTGCAGAGGGCCTCAGG - Intergenic
928665581 2:33547865-33547887 ATGCAATTCCAGGGTGCCTAAGG + Intronic
932941738 2:76174761-76174783 CTGCATTTGAAGAGGGCATTGGG + Intergenic
934732131 2:96666053-96666075 CTGCATTTCCAAAGGGCTAAAGG - Intergenic
936956109 2:118023939-118023961 TTGCATTTCCAGGGGCCCTCTGG + Intergenic
937200765 2:120203344-120203366 CTGCATTCCCAGAGTGACTTTGG + Intergenic
938038489 2:128056023-128056045 CAGTTTTTCCTGAGGGCCTAAGG + Intergenic
938118528 2:128618269-128618291 CTGCATTTGGGGAGGGCCTCGGG - Intergenic
939032713 2:137095628-137095650 CTTCAATTCCAGAGTCCCTAGGG + Intronic
939269669 2:139921328-139921350 CTGCTTCTGCTGAGGGCCTAAGG - Intergenic
940190566 2:151036447-151036469 GTGAAATTCCAGAGGGCCAAGGG + Intronic
940857859 2:158743708-158743730 CTGCAATCCCAGAAAGCCTAAGG + Intergenic
943959963 2:194251550-194251572 CTTCAGATCCAGAGGGCCTTTGG + Intergenic
946045563 2:216818125-216818147 CTGCACTTCCAGGTGGCATATGG - Intergenic
946082146 2:217130351-217130373 CTCCATTTCCAGAGGACGGAGGG + Intergenic
946672835 2:222124641-222124663 CTGCATTTCCAAAGTCCCTTAGG - Intergenic
948181018 2:235980375-235980397 CTGCATTTGGAGAGGGCTTCAGG + Intronic
948369757 2:237481195-237481217 CTGGATTTCCACAGCGCCTGGGG - Intergenic
948800093 2:240429582-240429604 CTGCCCTTCCAGAGGGCCTCAGG - Intergenic
948804613 2:240448149-240448171 CTGCCTCTCCACAGGGCCTGCGG - Intronic
949019708 2:241734423-241734445 CTGCGTTTCCTGAGGGCCTCCGG - Intergenic
1169854687 20:10089966-10089988 CTGCAGAGCCAGGGGGCCTAGGG + Intergenic
1170183224 20:13556694-13556716 CTGCATGTGCAGAGGCCCTGTGG - Intronic
1170481467 20:16769261-16769283 CTGCATCTGCTGAGGGCCTCAGG + Intronic
1171200448 20:23236773-23236795 CTGCATTTCCAGGATGCCTGGGG + Intergenic
1172362237 20:34321278-34321300 CTGCATTCCCAGATGGTTTAAGG + Intergenic
1175146569 20:56900981-56901003 CAGCATGTGCAAAGGGCCTAGGG + Intergenic
1176302453 21:5105017-5105039 GTGCATTTCCTGAGGCCCCATGG - Intergenic
1177108534 21:16993520-16993542 GTGCATGTCCAGAGGCCCCAAGG + Intergenic
1179854574 21:44156906-44156928 GTGCATTTCCTGAGGCCCCATGG + Intergenic
1183236437 22:36622289-36622311 CTGCATTTCCACAAGCCCTGCGG - Intronic
1184413037 22:44336881-44336903 CTGCTTTTCCAGGAGGCCGAGGG + Intergenic
949569089 3:5274356-5274378 ATTCCTTTCCAGAGGCCCTAGGG - Intergenic
950646371 3:14379405-14379427 CTTCATCTACAGAGTGCCTACGG + Intergenic
950856813 3:16113488-16113510 CTGCATTTCCAGATGGGTTTTGG - Intergenic
954241420 3:49296758-49296780 AGGAATTTTCAGAGGGCCTATGG - Intronic
955484429 3:59421435-59421457 TAGCATTTTCAGAGTGCCTAGGG - Intergenic
955540741 3:59973419-59973441 CAGCATGTGCAGAGGGCCTGTGG - Intronic
957837246 3:85611848-85611870 CTTCATTTCTAAAGGGCCAAAGG + Intronic
959090916 3:101901840-101901862 CTGTATTTCCAAAGGGATTAAGG + Intergenic
962149715 3:132880008-132880030 GTGAATTTCCAGTGGGCCTGGGG - Intergenic
963714583 3:148788368-148788390 CAGCATTTACAAAGGCCCTAGGG - Intergenic
964194640 3:154048438-154048460 CTTCTTTTCCAGTGGGCCTCAGG - Intergenic
966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG + Intergenic
967098781 3:186198756-186198778 CTGCATGTCTGCAGGGCCTATGG + Intronic
967623539 3:191661844-191661866 CTGCCTTTCCGGAGAGACTAAGG + Intergenic
968425584 4:520830-520852 CTGCATCGCCAGAGGGCAGATGG + Intronic
971575136 4:28263280-28263302 CTGCATCTTCTGAGGGCCTCAGG - Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
972047103 4:34680176-34680198 TTGCATTTGCAGAAGGCCTGGGG + Intergenic
978586824 4:110282939-110282961 CTGCCTTTCTAGAGAGACTAAGG - Intergenic
980676207 4:136085201-136085223 CTGTGTTCCCAGAGGGCTTATGG - Intergenic
984512460 4:180694859-180694881 CTTCATTTTCAGAGGGCATTTGG + Intergenic
986314527 5:6577665-6577687 ATGCATATTCAGAGGGCCCATGG - Intergenic
986431462 5:7685148-7685170 CTGCAAGTCCAGATGGCCTGAGG - Intronic
986986700 5:13508326-13508348 CTGCATTATGAGAGGGCCCAAGG - Intergenic
987462623 5:18231425-18231447 CTGCATTTGGTGAGGGCCTCAGG + Intergenic
987495795 5:18642881-18642903 CTGCATTTGGTGAGGGCCTCAGG - Intergenic
988606886 5:32686257-32686279 CTGCATCTAGTGAGGGCCTAAGG - Intergenic
989443128 5:41495352-41495374 CTGCCCCTCCAGAGGGCCTGAGG + Intronic
991549904 5:67824540-67824562 CTGCATTTGGTGAGGGCCTCAGG - Intergenic
994843162 5:104951747-104951769 CTGGAGTTCCAGCAGGCCTAGGG + Intergenic
995949774 5:117696455-117696477 CTGCATTTCCATATGGCTTTTGG + Intergenic
996596101 5:125204457-125204479 CTCCATTTACATAGGGCATATGG + Intergenic
1001546853 5:172575568-172575590 CTGCTTATCCAGTGGGCCTTGGG + Intergenic
1004330154 6:14713794-14713816 CCGCATTCCCAGAGAGCCTGGGG - Intergenic
1006299320 6:33185394-33185416 CTGCAGTTGGAGAGGGCCTCCGG + Intronic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1006569798 6:34992949-34992971 ATGCATTTCCAGTGGGCTAAGGG + Intronic
1011296027 6:85827177-85827199 ATGCATTTCCTGAGGGCCTGGGG + Intergenic
1015791700 6:136969847-136969869 CTCCCGTCCCAGAGGGCCTACGG - Intergenic
1021355683 7:19651191-19651213 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1022151817 7:27616070-27616092 ATGCATTTTCTGAGGGCCTCAGG + Intronic
1023926130 7:44671164-44671186 CTGCATTTGGTGAGGGCCTCAGG + Intronic
1023980255 7:45065426-45065448 TTTCATTTCCAGAGGGCCAGTGG + Intronic
1024790243 7:52957674-52957696 GTGCCTTTCCACAGGGCCTTTGG - Intergenic
1026879602 7:73900327-73900349 CTGCATTTCCTGAGGCCCAAAGG - Intergenic
1026938994 7:74275772-74275794 CTCCATCTCCAGGGGGCCTGCGG + Intergenic
1028219022 7:88172970-88172992 CTTCATTTCCACAGGAACTAAGG + Intronic
1032200875 7:129821945-129821967 CTGCATGGCCAGAAGGCCGAGGG - Intergenic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1033467452 7:141608406-141608428 CTGCATGTCCAAAGGCCCTGAGG + Intronic
1033598905 7:142875216-142875238 CTGCATTTCCATGGTGCCCAGGG + Intronic
1036074404 8:5478833-5478855 CTGCATTTCCAGAGCACTCAAGG + Intergenic
1036690423 8:10941390-10941412 CTCCATCTCCACAGGGCCCATGG - Intronic
1037388550 8:18367930-18367952 CTGCTTTACAAGAGGTCCTACGG + Intergenic
1040100604 8:43499219-43499241 CTGCATCTCCAGAGAGTCTGTGG + Intergenic
1041419289 8:57648368-57648390 CTCCATTTCTAGAGGGTTTAAGG + Intergenic
1044840914 8:96336384-96336406 CTGCACTTACAGAGGCCCTTGGG + Exonic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1048379190 8:133849319-133849341 CTGCAGTCCCAAAGGGCCCAAGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1049451681 8:142665343-142665365 CTGCACTTCCCGATGGCCAAGGG + Exonic
1049849634 8:144823878-144823900 CTGACTGTCCAGAGGGCCCAGGG + Intergenic
1050335325 9:4584695-4584717 CTTAATTTCCAGAGAGCCTGGGG - Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1051557218 9:18397841-18397863 CTGGATTTCCAGATGTCTTAAGG + Intergenic
1052398033 9:27964957-27964979 CTGCATTTCCAGAGGTTTTTTGG - Intronic
1056688066 9:88783039-88783061 CTGGATTTACAGTGGGCCTGGGG + Intergenic
1056825234 9:89872495-89872517 TTGCATTTCCACAGGGTCCAGGG - Intergenic
1057821060 9:98331461-98331483 CTGCGTTTCCACAGGGCCCCGGG + Intronic
1059965082 9:119605907-119605929 CAGCATTTCCTGGAGGCCTAAGG - Intergenic
1060242352 9:121914817-121914839 CTCCATTCCCAGATAGCCTAGGG - Intronic
1060815545 9:126633265-126633287 CTACATTTCCAGATGGCCCCTGG + Intronic
1061894459 9:133639939-133639961 CTGCTTTTCAAGAGGCCCTTTGG + Exonic
1186631066 X:11349401-11349423 CTTTATTTCTAGAGGGCCAAAGG - Intronic
1187536826 X:20148573-20148595 GTTCCTTTCCAGAGGCCCTAGGG - Intergenic
1190499200 X:51058373-51058395 CTGCATGCTCAGAGGGCCCAAGG + Intergenic
1193773826 X:85619804-85619826 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1194247660 X:91535895-91535917 CTGCATATTCAGTGGGCATATGG - Intergenic
1196726152 X:118897460-118897482 TTGGATTACCAGAGGCCCTAAGG + Intergenic
1197792744 X:130271775-130271797 CTTCCTTTCCAGATGGCCTCTGG + Intergenic
1198721327 X:139624231-139624253 ATGCATTTCAAAAGGGACTATGG + Intronic
1198916186 X:141675029-141675051 CTGCATTTCCAGAGCACTTCGGG - Intronic
1199065499 X:143412322-143412344 CTGCTTCTCAGGAGGGCCTAAGG - Intergenic
1200566680 Y:4777425-4777447 CTGCATATTCAGTGGGCATATGG - Intergenic
1200844233 Y:7815002-7815024 CTCCATGTCAGGAGGGCCTAAGG + Intergenic
1200944440 Y:8819460-8819482 CTGCATTTCCAGAGCACTTTGGG - Intergenic