ID: 1078466675

View in Genome Browser
Species Human (GRCh38)
Location 11:11555175-11555197
Sequence CCTGATGGGCTGCTCAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078466669_1078466675 -10 Left 1078466669 11:11555162-11555184 CCTGCTCAGGATCCCTGATGGGC 0: 1
1: 1
2: 3
3: 19
4: 179
Right 1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG 0: 1
1: 0
2: 2
3: 35
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078466675 Original CRISPR CCTGATGGGCTGCTCAGGGC GGG Intronic
900102275 1:966946-966968 CCGGATGAGCTCCCCAGGGCGGG - Intronic
900405927 1:2492992-2493014 CCCGAGGGGGTGCTCAGGGAAGG - Intronic
900707946 1:4092141-4092163 CCTGGTGGGGTGTGCAGGGCTGG - Intergenic
900772253 1:4554494-4554516 CCTGGGGGGATGCTCAGGCCAGG + Intergenic
901239590 1:7685323-7685345 CCTGTTGGAATGCTCAGGGACGG + Intronic
901875700 1:12165948-12165970 CCTGAGGGGCTGCTGAGACCAGG - Intergenic
902576284 1:17379826-17379848 CCTGTGGGGCTGCCCAAGGCTGG - Intronic
902896653 1:19484703-19484725 CCTGATGAGAGGCTCAGGGCGGG + Intronic
903169135 1:21541360-21541382 CCAGCTGGGCAGCTCAGAGCAGG - Intronic
904358037 1:29954166-29954188 CCTGAAGGGCAGCTCAGCACAGG - Intergenic
904495201 1:30882553-30882575 CCTGATGGGGTGCTCCTGGGAGG - Intronic
905672949 1:39804401-39804423 CCAGATGGGTTGCTCAGGGAAGG + Intergenic
905849958 1:41266452-41266474 CCTGCTGGGCTGGGCTGGGCTGG + Intergenic
907115031 1:51960613-51960635 CCTGATGTGTTGCTAAGGACAGG - Intronic
907440334 1:54474843-54474865 CCAGATGGGCTGCGCAGCGGCGG + Intergenic
907931570 1:59005759-59005781 ACTGGCTGGCTGCTCAGGGCAGG + Intergenic
908408002 1:63833584-63833606 TCTGATTGGCTGCTCTGGGAGGG + Intronic
911357106 1:96835953-96835975 CCTGGTGGTCTGCCCAGGCCAGG - Intergenic
912448053 1:109752251-109752273 CCTGAGGGGAATCTCAGGGCTGG - Intronic
912771308 1:112466246-112466268 CCCGACGGGCTACTCCGGGCTGG + Intergenic
914753424 1:150550327-150550349 CCTGCCGGGCTGCGCAGGGGAGG + Intronic
915527684 1:156486166-156486188 TCTGCTGGGCCACTCAGGGCTGG - Intronic
916507256 1:165439390-165439412 GCTGATGAGCTGCTCAGGGTGGG - Intronic
917122538 1:171656730-171656752 CGGGATGGGCTGCACAGGGGAGG + Intergenic
918181614 1:182089465-182089487 GCTAGTGGGCTGCTCAGGGGAGG - Intergenic
920314136 1:205065728-205065750 CCTGCTGCACTGGTCAGGGCCGG + Intronic
921014294 1:211173719-211173741 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
921297084 1:213714539-213714561 CCTGATGGCCAGCTCTGGGCTGG + Intergenic
923273638 1:232378839-232378861 CCTGCTGGGCTTCCCAGGGAAGG + Intergenic
923986397 1:239387069-239387091 ACTGAAGGGCGGCTCCGGGCAGG + Intronic
924828030 1:247562403-247562425 CCTTATTTACTGCTCAGGGCTGG + Intronic
1063615913 10:7600466-7600488 TCTGGTGGGCTGGGCAGGGCTGG - Intronic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1065255270 10:23860146-23860168 CCTCATGAGCAGCTCTGGGCAGG + Intronic
1067459951 10:46450982-46451004 CCTGTTTGGCTGCCCAGGCCGGG + Intergenic
1069547341 10:69338211-69338233 CCAGACCGGCTGCACAGGGCGGG - Intronic
1069984440 10:72273892-72273914 CCTTATAGGCTGCTCCGCGCTGG + Intergenic
1071438776 10:85670957-85670979 CCTGATGGCATTCTCAGAGCAGG - Intronic
1072221629 10:93332120-93332142 ACTTATTAGCTGCTCAGGGCAGG - Intronic
1072610973 10:97017575-97017597 GAAAATGGGCTGCTCAGGGCAGG + Intronic
1073081246 10:100862334-100862356 CATGATGGGGTGGTCAGGGGTGG - Intergenic
1073497931 10:103911288-103911310 ACAGAGGGGCTGCTCAGAGCAGG + Intronic
1075165576 10:120065258-120065280 CCTGAGGTGCTGTTCATGGCTGG + Intergenic
1075872804 10:125782933-125782955 CCTGATGGGTCCCTCAGGGGCGG - Intergenic
1076475613 10:130749794-130749816 CTTGTTGGGGAGCTCAGGGCAGG - Intergenic
1076604521 10:131680942-131680964 CCTGATAGGATGCTCAGGGTTGG - Intergenic
1076696506 10:132249798-132249820 CCTCATGGGTTGCTGATGGCAGG - Intronic
1076697090 10:132252068-132252090 CCTGCTGGGCCCCTCAGGGCTGG + Intronic
1076890391 10:133280537-133280559 CCTGTGGGGCTGATCAGGCCTGG - Intronic
1077049620 11:560888-560910 CCCTATTGGCTGCTCAGCGCGGG - Intronic
1077110587 11:860434-860456 GCTGATGCACTGCTCAGGGAGGG + Intronic
1077268704 11:1665212-1665234 CCTGATGGGCTGCTCTCAGGTGG + Intergenic
1077272071 11:1686091-1686113 CCTGATGGGCTGCTCTCAGGTGG - Intergenic
1077303226 11:1856593-1856615 CCTGAGGGGCTGCTCTGGCAGGG + Intronic
1077767673 11:5178592-5178614 CCTGATGGGAATCCCAGGGCTGG - Exonic
1078079369 11:8192907-8192929 CCTCATGAGCTGCTAAGGGGAGG + Intergenic
1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG + Intronic
1080022885 11:27581922-27581944 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1080474946 11:32581729-32581751 CCTGATGATCTGCTGTGGGCTGG + Intergenic
1080687135 11:34524934-34524956 CCTGGGAGGCTGCTCGGGGCCGG - Intergenic
1081579780 11:44344361-44344383 ACTGCTGGGGTGCCCAGGGCTGG + Intergenic
1081742212 11:45448665-45448687 TGGGATGGGCTGCCCAGGGCGGG - Intergenic
1082950025 11:58804823-58804845 CCTCCAGGGCTTCTCAGGGCAGG - Intergenic
1083291732 11:61694337-61694359 CGTAAATGGCTGCTCAGGGCAGG + Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083808498 11:65088842-65088864 CCTGATGGTAGGCTCAGGGCAGG - Exonic
1084087210 11:66860121-66860143 CATGGGGGGCTGCTCGGGGCAGG + Exonic
1084119893 11:67062811-67062833 CTTGACTGCCTGCTCAGGGCTGG - Intronic
1084593770 11:70105276-70105298 CCTGATGGGCTGCATAGGGATGG - Intronic
1084943429 11:72626332-72626354 CCTGTTGGGCTGCACAGGCCCGG - Intronic
1085134242 11:74070960-74070982 GCTAATGGGGTGGTCAGGGCAGG - Intronic
1085507907 11:77070541-77070563 CCTCATGGGCTTCTCCGGGCAGG + Intronic
1086059854 11:82689566-82689588 CTTGATAGGCTGCACACGGCTGG - Intergenic
1088237591 11:107742051-107742073 CCTTAGGAGCTGTTCAGGGCCGG + Intergenic
1089456413 11:118628299-118628321 CCCCATGGGCTGCCCAGCGCCGG - Exonic
1089513601 11:119017377-119017399 CCTGAAGGGCTGCCCTGGCCAGG + Exonic
1089662815 11:119996660-119996682 GCTGTTGGGCTGGGCAGGGCTGG - Intergenic
1091087681 11:132738582-132738604 CCTGATGGACTGCTCAGTTTGGG + Intronic
1091285617 11:134407120-134407142 ACTGAGGAGCTGCTCAGGGTGGG + Intronic
1092062562 12:5563399-5563421 CCTCCTGGGCTCCTCAGAGCCGG + Exonic
1092743321 12:11650223-11650245 CGTGCTGGGCTCCTCAGAGCAGG + Intronic
1093443838 12:19230818-19230840 GCTGATGGGCTCCTCAGGCACGG + Intronic
1095635133 12:44423812-44423834 CCTGATTGGCTGTTCTGAGCTGG + Intergenic
1096529598 12:52234397-52234419 CCTGCTGGGCTGTTCTGGCCAGG + Intronic
1096989795 12:55791157-55791179 CCTCAGTGGCTGCTTAGGGCTGG + Intronic
1097051169 12:56224242-56224264 CCCGATTGGCTGGGCAGGGCAGG + Intronic
1098161203 12:67649224-67649246 CCACAGGGGCTGCCCAGGGCCGG - Intronic
1099176341 12:79427218-79427240 CCTGATGAGAAGCTCAGGGAGGG + Intronic
1101062523 12:100987011-100987033 GCTGAGAGGCTGCTCAGGGGAGG + Intronic
1102481930 12:113229786-113229808 TTAGATGGACTGCTCAGGGCCGG - Intronic
1103059322 12:117846203-117846225 TTTGATGGGCTGATCAGAGCAGG - Intronic
1103623909 12:122204630-122204652 CCTGGTGGGCTGCGGAAGGCTGG - Exonic
1103903516 12:124315657-124315679 CCTGCTGGGCTGCCCCAGGCTGG - Exonic
1104844807 12:131841421-131841443 CCTGCTGGGCTTCCCAGGCCTGG - Intronic
1105323433 13:19348109-19348131 CCAGGTGGGCTGCAGAGGGCAGG + Intergenic
1105523604 13:21153778-21153800 CCGGATGAGCTGCTTAGGGAGGG - Exonic
1105770459 13:23606480-23606502 CCAGGTGGACAGCTCAGGGCAGG - Intronic
1105873955 13:24537728-24537750 CCAGGTGGGCTGCAGAGGGCAGG - Intergenic
1106031398 13:26008595-26008617 CCTGTTCAGCTGCTCAGGTCTGG - Intronic
1106178868 13:27354152-27354174 CCTGGAGGGCTGCTCTGAGCAGG - Intergenic
1106863557 13:33937807-33937829 TCTAATGTGCTCCTCAGGGCAGG + Intronic
1108559454 13:51628189-51628211 CCTGAGGGGCGGCTCAGCGCAGG - Intronic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1113964572 13:114145466-114145488 ACAGATGGGCTGGTCCGGGCAGG + Intergenic
1114696565 14:24632074-24632096 CCTGAGGGGCTGCACAGCTCTGG + Exonic
1115503790 14:34074484-34074506 CCTGATGGGATGCGCTGGGAAGG + Intronic
1117065839 14:52012804-52012826 TCTGCTGGGCTTCTCAGAGCAGG - Intronic
1118320563 14:64749870-64749892 CCTGAGGAGCAGCTCAGGCCTGG + Exonic
1119636076 14:76274530-76274552 CCTCATGGGCTGCTGATGGGAGG - Intergenic
1119720662 14:76888102-76888124 CCTGATGGGAAGGTGAGGGCAGG + Intergenic
1121014379 14:90539405-90539427 CCTGATTGGAGGCACAGGGCTGG - Exonic
1121419134 14:93800038-93800060 TGTGCTGGGCTGCTCAGTGCTGG - Intergenic
1121794218 14:96722236-96722258 CCTGTTGGGGTCCTCAGTGCAGG + Intergenic
1122746214 14:103898657-103898679 CTTGATGCTCAGCTCAGGGCAGG + Intergenic
1124094680 15:26638148-26638170 CCTGGTGGGCTGATGAGGGATGG - Intronic
1124227674 15:27908738-27908760 TCTAATGGGCTTCTCTGGGCAGG - Intronic
1124589365 15:31039851-31039873 CCTGGTGGGCTGGTCAGGTGGGG + Intronic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1127903122 15:63355735-63355757 ACTGATGGGGGGCTCAGGCCTGG - Intronic
1128633906 15:69290882-69290904 GCTGTGGGGCAGCTCAGGGCAGG - Intergenic
1128720000 15:69941303-69941325 CCTGATTGGCTCGCCAGGGCTGG + Intergenic
1128764489 15:70242893-70242915 CCAGCTGGGCTGCTGATGGCAGG + Intergenic
1129093248 15:73174363-73174385 CCTGCTGGGGTGCTGTGGGCTGG + Intronic
1129413205 15:75361040-75361062 ACGGATGGGCTGCCCAGGTCAGG - Exonic
1129603051 15:77011408-77011430 CCAGCTGGGCTGCTCAGGTGAGG + Intronic
1129644885 15:77420384-77420406 CCTGATTGGCTGCGGAGGGCGGG + Intergenic
1129654860 15:77517177-77517199 CCTGATGGTCTCCGCAGGGATGG - Intergenic
1131077512 15:89504594-89504616 CCTGATGGGCTGCTCCAAGAAGG + Intergenic
1132745133 16:1433333-1433355 CCTGCCGGGCAGCTCAGGACAGG - Intergenic
1133024174 16:2980496-2980518 CCTGACGGGCTGCACTGGGGAGG - Exonic
1133237740 16:4395425-4395447 GGGGATGGGCTGCTCAGAGCTGG - Intronic
1134040622 16:11065685-11065707 CCTCATGGGCTGGTTAGGGAAGG + Intronic
1134084158 16:11345385-11345407 CCTGATTGGTGGCTGAGGGCCGG + Intronic
1136567676 16:31079914-31079936 GCTGAAGGGCCGCTCAGAGCTGG - Exonic
1138352581 16:56353819-56353841 CCTGCTGGGCTGCCCAGAGCTGG + Intronic
1139292236 16:65869502-65869524 GCAGATGGGATGCACAGGGCAGG - Intergenic
1139421756 16:66853489-66853511 GCAGATGGGCAGCTCAGGCCCGG - Exonic
1139839670 16:69868265-69868287 AATGATGGGCTGGGCAGGGCGGG - Intronic
1139954495 16:70686612-70686634 CCGGATGGGGTGCCCAAGGCTGG + Intergenic
1140122988 16:72099296-72099318 TCTGAGGGGCTGATCGGGGCTGG + Intronic
1141160765 16:81627928-81627950 CCTGACGGGAAGCTGAGGGCAGG + Intronic
1142217856 16:88838584-88838606 CCTGCAGGGCTGCTGTGGGCCGG - Intronic
1142573557 17:891731-891753 CCTGATGGGCTGTGCATGGTGGG - Intronic
1142869772 17:2812525-2812547 TCTGATGGGCTTCTCATGCCAGG + Intronic
1142964570 17:3572527-3572549 CCTTGTGAGCTCCTCAGGGCAGG - Intronic
1142989108 17:3717602-3717624 CGTGAAGGGTTGCTCTGGGCAGG - Intronic
1143676386 17:8436071-8436093 CCTAAGGGGCTGCGCTGGGCCGG + Intronic
1143906859 17:10216166-10216188 CCTGATGACGTGCTCAGGTCTGG - Intergenic
1144768022 17:17743511-17743533 AGTGATGGGCTGCTGCGGGCAGG - Intronic
1144899628 17:18572759-18572781 CTTGATAGGCTGCACACGGCTGG - Intergenic
1145907096 17:28522234-28522256 GCTGAGGGTCTGCTCTGGGCTGG - Intronic
1146182399 17:30706587-30706609 GTGGGTGGGCTGCTCAGGGCTGG + Intergenic
1146272423 17:31493066-31493088 CCTGCTGGGCGGTTCTGGGCTGG - Intronic
1146670365 17:34733433-34733455 GCTGCTGGGCTGAGCAGGGCTGG - Intergenic
1146677182 17:34781669-34781691 CCGGATGTGCTGCACAGTGCTGG - Intergenic
1147219726 17:38921179-38921201 CCTGAGGGGCTGGGCTGGGCTGG + Exonic
1148991611 17:51671247-51671269 CCTGAGGGACAGCTCAGGGCAGG - Intronic
1149753911 17:59172421-59172443 GCTGAAGGGCTCCTCAAGGCTGG - Intronic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1152363642 17:79843528-79843550 CCGGGTGGGCTTCTCCGGGCGGG - Intergenic
1153894171 18:9543851-9543873 CTTGGTGGGCAGCACAGGGCAGG - Intergenic
1156154120 18:34281357-34281379 CCTGATAAGCAGCGCAGGGCAGG + Intergenic
1157563883 18:48666823-48666845 ACTGCTGAGCTGCACAGGGCTGG + Intronic
1157595527 18:48861477-48861499 GATGCGGGGCTGCTCAGGGCAGG + Exonic
1158630760 18:59112105-59112127 CCTGAAGGGATGCACAGGGAGGG - Intergenic
1158724552 18:59958206-59958228 TCTGCTGGGCTGAGCAGGGCAGG + Intergenic
1160869405 19:1270185-1270207 CCTGGGGGGCACCTCAGGGCAGG - Intronic
1161040471 19:2108464-2108486 CCTGCTGCGCTGCTCACCGCAGG - Intronic
1161436569 19:4267251-4267273 CATGATGGGCTTCTCAGAGGAGG + Intronic
1161591786 19:5132243-5132265 CATGATGGGCGGTTCAGGGCTGG + Intronic
1161934787 19:7364937-7364959 GCTGATGGGCTGCCCAGGAAGGG + Intronic
1162097856 19:8321538-8321560 CTTGATAGGCTGCACACGGCTGG - Exonic
1162908149 19:13835671-13835693 CTTGAGGGGGTTCTCAGGGCAGG - Intergenic
1162935003 19:13977887-13977909 CCGGATGGCCTGCTGGGGGCTGG + Intronic
1162976425 19:14209214-14209236 GTGGGTGGGCTGCTCAGGGCTGG - Intergenic
1163386702 19:17004475-17004497 CCTGGGGGGCTGCTCAGGGAAGG - Intronic
1163464786 19:17460997-17461019 CCTGAGGGGCCTCTAAGGGCGGG + Intergenic
1163643814 19:18476912-18476934 CCCGATGGTCCGCACAGGGCTGG - Intronic
1163756226 19:19107868-19107890 CCTGCTGGGCTGCTCTGTCCTGG + Intronic
1164642493 19:29836638-29836660 CCTGCAGGGCTGCCCAGAGCTGG - Intergenic
1164766602 19:30777273-30777295 CCTGCTGGGCCACTTAGGGCAGG - Intergenic
1164941033 19:32252482-32252504 CATGGTGGGCTGCTCTGGGGAGG - Intergenic
1165172899 19:33906242-33906264 CCTGGCGGGCCGCGCAGGGCGGG - Intergenic
1165862864 19:38918314-38918336 GCTGCTGAGCTGCTCGGGGCAGG + Intronic
1166789754 19:45391896-45391918 TCTGGTGGGCTGCTCTGGGACGG + Exonic
1166943781 19:46384700-46384722 CCAGATGGGCTGCTCCTGCCTGG - Intronic
1167077750 19:47259512-47259534 ACTGATGGGCAGTTCAGGGCAGG + Intronic
1167124169 19:47538152-47538174 GCTGATGAGCTGGTCAGGGCTGG + Exonic
1167213525 19:48148921-48148943 CCTCGTGGGCCGCCCAGGGCTGG + Intronic
1167642082 19:50687554-50687576 CCTGCGGGGCTGCTGAGGCCAGG - Intronic
1168287968 19:55343738-55343760 GATGAGGGGCTGCTGAGGGCCGG + Exonic
925159224 2:1672097-1672119 GCTTCTGGGCTTCTCAGGGCTGG + Intronic
925291741 2:2752523-2752545 CCTGAGGGGCGGCCCAGGACAGG - Intergenic
927035951 2:19176581-19176603 CCTGATGGAGTGGTCAGGGAAGG + Intergenic
929447350 2:42011705-42011727 CCTAAGGGGCAACTCAGGGCTGG + Intergenic
932144752 2:69307300-69307322 CCTGTGGGGGTGCTCTGGGCTGG - Intergenic
932479230 2:72028687-72028709 CCTGCTGCTCTGCTCAAGGCTGG - Intergenic
932576874 2:72967436-72967458 TCTGATGGGGTGGTCAGGGAGGG + Intronic
932802602 2:74754790-74754812 CTTGATAGGCTGCACACGGCTGG + Intergenic
937814707 2:126238196-126238218 CGTGCTGGGCTCCCCAGGGCTGG - Intergenic
938202679 2:129388262-129388284 GCTGAGGGGCTCCTTAGGGCTGG - Intergenic
941245321 2:163088610-163088632 CCTGATAGGCCCGTCAGGGCAGG + Intergenic
943037912 2:182768973-182768995 CCTGTTGGGGAGTTCAGGGCTGG - Intronic
943903446 2:193470304-193470326 CCTAATGGGCTGTTGAGGACTGG - Intergenic
944270956 2:197785344-197785366 CCTGATTGGCTGCTGGCGGCGGG + Intronic
946170513 2:217892685-217892707 CCGCATGGGTTGCTCAGGACAGG + Intronic
947573737 2:231256104-231256126 CTTGATAGGCTGCACACGGCTGG - Intronic
948673511 2:239583806-239583828 GCTGCTGGACTGCTCAGGGCCGG + Exonic
948740242 2:240041899-240041921 CCTGGTGGGCTTCTCACAGCAGG - Exonic
948884784 2:240877212-240877234 GCTGTTGGGCTACACAGGGCTGG - Intronic
1168762290 20:357401-357423 TCTAATAGGCTGCTCAGGGAAGG - Intronic
1169215138 20:3789193-3789215 CCTGAAGGACAGCTCTGGGCAGG - Intronic
1170569339 20:17624114-17624136 CTTGATGGGCTTCTCCGTGCTGG - Intronic
1171418435 20:24999735-24999757 CCTGAGAGGCAGCTCTGGGCTGG + Intergenic
1173202051 20:40961464-40961486 GCTGAGAGGCTGCTGAGGGCTGG - Intergenic
1173594206 20:44248113-44248135 CCTGATGGGCTGAGCCGAGCTGG - Intronic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1174416876 20:50373240-50373262 CCTAATGGGTTCCACAGGGCAGG - Intergenic
1174778876 20:53370294-53370316 CCTGGGGAGCTGCTCTGGGCAGG + Intronic
1175284535 20:57829106-57829128 CCTGAGGGGCAGGGCAGGGCAGG + Intergenic
1175410681 20:58766114-58766136 CCTGATTGCCTGCTCGGTGCTGG - Intergenic
1175883162 20:62272036-62272058 CATGAAGGGATGCTCAGAGCAGG + Intronic
1175946850 20:62562889-62562911 CCTGAGGGGCAGCACAGGACTGG + Intronic
1179139578 21:38712901-38712923 ACAGATGTGCTGCTGAGGGCGGG - Intergenic
1179609145 21:42538135-42538157 CCAGATGGGCTCCTGAGAGCTGG - Intronic
1180968352 22:19802097-19802119 CATGACGGGCTCCTCATGGCAGG + Exonic
1181051974 22:20242173-20242195 CCAGATGGGATGGTAAGGGCCGG + Exonic
1181055567 22:20259087-20259109 CCTGGTGGGCAGCTCGGGGTTGG + Intronic
1181419106 22:22785647-22785669 CCTGAGGTGCTGCCCAGGACAGG - Intronic
1181557082 22:23677394-23677416 CCTGATGAGCAGCTCAGAGCAGG + Intergenic
1181697294 22:24600146-24600168 CCTGATGAGCAGCTCAGAGCAGG - Intronic
1182351789 22:29703782-29703804 CCTCAGGAGCTCCTCAGGGCAGG + Intergenic
1183092905 22:35535652-35535674 CCTGAGGGGCTGCTCATCTCTGG - Intergenic
1183196619 22:36358088-36358110 CCTGATGGGATTCCCAGGGTGGG - Intronic
1183647425 22:39134637-39134659 CCTGAGGGGGTGGTCAAGGCGGG - Exonic
1183716243 22:39535172-39535194 CAGGCTGGGCTGCCCAGGGCGGG + Intergenic
1183952409 22:41358977-41358999 AGTGATGGGCTGCCCAGGGCTGG + Exonic
1184017826 22:41799548-41799570 ACTGATGGCCTCCTCAGGGAAGG + Intergenic
1184192691 22:42905501-42905523 TGTGATGGGCTGCCCAGGCCAGG - Intronic
1184197379 22:42939080-42939102 GCTGATGGGCTGCGCTGGGACGG - Intronic
1184219786 22:43092401-43092423 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1184877054 22:47282661-47282683 CCTGGTGCCCAGCTCAGGGCAGG + Intergenic
1185023207 22:48392759-48392781 CCTGAGGGGCTCCTCATGCCTGG - Intergenic
1185196304 22:49472083-49472105 CCTGATGGGCATCTCTGTGCAGG + Intronic
950031918 3:9859374-9859396 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
950053817 3:10010480-10010502 GCAGATGGGGTGCTCAGGGAGGG - Intronic
950120818 3:10481469-10481491 TTTGATGGGGTGTTCAGGGCAGG - Intronic
950415605 3:12867452-12867474 GCAGATGGGGTGCTCAGGGAGGG - Intronic
950417199 3:12875508-12875530 GCGGATGGGGTGCTCAGGGAGGG - Intergenic
951460191 3:22943142-22943164 GCTGATGAGCTGGACAGGGCTGG + Intergenic
951491299 3:23272467-23272489 ACTGATGGGCTCCTCAAGGGTGG + Intronic
954368897 3:50160108-50160130 CCCCAGGGGCTGCTCAGGGCAGG - Intronic
954387751 3:50253193-50253215 TCTGAGGGGCTGGGCAGGGCAGG + Intronic
954436911 3:50501134-50501156 TCTGTGGGGCTGCTCAGGGATGG - Intronic
954672785 3:52299547-52299569 CTGGCTGGGATGCTCAGGGCTGG - Intergenic
955343265 3:58142049-58142071 CGTGATGGGCTGATCAGTGAGGG - Intronic
955939380 3:64133319-64133341 CTTGATGGGAAGCTCAGGCCGGG + Intronic
957255107 3:77826086-77826108 CCCCAGGGGCTGTTCAGGGCTGG + Intergenic
958048817 3:88319077-88319099 CCTGACCAGCTGCTCAGGACTGG + Intergenic
958762781 3:98328803-98328825 CCTCAGGTGCTGTTCAGGGCTGG - Intergenic
960715166 3:120568094-120568116 GCTGCTGTGCTGGTCAGGGCTGG - Intergenic
961163501 3:124749056-124749078 CCTGCAGGGCTGCTAAGTGCAGG - Intergenic
961713132 3:128842287-128842309 GCAGATGGGGTGCTCAGGGAGGG + Intergenic
961783974 3:129338382-129338404 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
961785223 3:129343458-129343480 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
962250659 3:133834101-133834123 CCTCAGGAGCTGTTCAGGGCTGG + Intronic
962411223 3:135143296-135143318 CCTGGTGGGCTGCTCTGAGGAGG + Intronic
962412190 3:135151057-135151079 CCTACTGTGCTGCTCAGGCCAGG + Intronic
964154848 3:153572792-153572814 TCTGATGACCTGCTCTGGGCAGG - Intergenic
967890608 3:194361763-194361785 GGTGATGGGCTGGGCAGGGCAGG - Intronic
967938337 3:194747171-194747193 CTGGAAGGGCTGCCCAGGGCAGG + Intergenic
968154417 3:196367671-196367693 CCTGAGGGGCAGCTCTGGGAGGG - Intronic
968235062 3:197026565-197026587 GCTGATGGCCAGCTCAGGCCAGG + Intronic
969061729 4:4440963-4440985 TCTGAAGGGCTGACCAGGGCTGG + Intronic
969300934 4:6296499-6296521 ACTGATGGTCTGCTCAGAGCTGG + Intronic
971635041 4:29047414-29047436 CCTGAAGGGCTCCTCAAGTCCGG - Intergenic
979517971 4:121632934-121632956 CCTGATGAGTGGCTCAGCGCAGG - Intergenic
979779480 4:124632532-124632554 CCTGAGGGGCAGCTGAGGCCGGG - Intergenic
984814238 4:183822061-183822083 CCTGAAAGGCTGATCAGGACGGG - Intergenic
984937766 4:184904268-184904290 CCTGAGGAGTTGCTCTGGGCTGG - Intergenic
986295538 5:6434839-6434861 CCTGATGCGGGGCTCAGGGAAGG - Intergenic
986331499 5:6719612-6719634 CCTGAGGTGCTTCTCAAGGCAGG - Intronic
990298627 5:54428270-54428292 CCAGATGGACTGCTCATGGAAGG - Intergenic
992013883 5:72557006-72557028 CCAGAGGGGCTGCTTCGGGCAGG + Intergenic
994745975 5:103678754-103678776 CCTGTTGGGCTGATCAGAGGAGG + Intergenic
995805900 5:116052020-116052042 CCTGAAGGGCTGCCCTGGCCAGG + Intronic
997369235 5:133347155-133347177 CATGATGGGTTGATCAGTGCAGG + Intronic
997690723 5:135825882-135825904 CCTCAGGGGCTGCCCAGGGCTGG + Intergenic
998141340 5:139701310-139701332 CCTGATTGGCTGCTCCCGGTTGG - Intergenic
998470773 5:142382218-142382240 CCTGATGGGCCTCAGAGGGCAGG - Intergenic
999088303 5:148912588-148912610 CCTGCTGCCCTGCTCAAGGCAGG + Intergenic
1001546979 5:172576290-172576312 CCTGATTGGATCCTCAGTGCTGG + Intergenic
1001981866 5:176043636-176043658 CCTGGTGTGCTGCTGAGGCCTGG + Intergenic
1002235599 5:177800421-177800443 CCTGGTGTGCTGCTGAGGCCTGG - Intergenic
1002278914 5:178119707-178119729 CCTGATGGGCTCCTCCGGAAGGG + Exonic
1002346515 5:178551745-178551767 CCTGAGGGGGTGCTCAGGGCAGG - Intronic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1004216642 6:13710786-13710808 CCTGTTGTGCTGCTCCGGGTGGG - Intronic
1005581213 6:27237171-27237193 CCTGATGGTCTGCTCACCCCTGG - Intergenic
1005714991 6:28538612-28538634 CCTGGTGGGCAGCTCAGGATGGG - Intergenic
1006389967 6:33752413-33752435 CCTGGGGAGATGCTCAGGGCAGG - Intergenic
1006412930 6:33885745-33885767 CCAGCTGGGCTCCTCAGAGCAGG + Intergenic
1006638107 6:35474668-35474690 CATGATGGGCAGGTGAGGGCAGG - Exonic
1006797129 6:36738896-36738918 CCCTCTGGCCTGCTCAGGGCAGG + Intergenic
1006844809 6:37054870-37054892 TCAGATGGGCTGATCAGGGAGGG - Intergenic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1006923390 6:37640703-37640725 GCTGATGGGGTGCTGAGGGGAGG + Intronic
1007354864 6:41306902-41306924 AGTGATAGGCTCCTCAGGGCTGG + Intergenic
1008542048 6:52554031-52554053 GCGGATGGTGTGCTCAGGGCTGG - Intronic
1012393745 6:98772021-98772043 CCTGATTGGCAGGTGAGGGCAGG - Intergenic
1014815210 6:125927924-125927946 CCTTCTGGGCTGCTCAGGCTGGG + Intronic
1015626093 6:135181847-135181869 CCTGGTGGGCTCCCCGGGGCTGG - Intronic
1016352406 6:143182535-143182557 CCTAATTGGCTGCTCGGGGTAGG - Intronic
1016649034 6:146442455-146442477 CCTCATGGGCAGCTCAAGCCAGG + Intergenic
1018912127 6:168107427-168107449 CCTGAGGGGATGCTCAGATCAGG - Intergenic
1019004214 6:168782708-168782730 CCTGCTGAGCTGCACATGGCCGG + Intergenic
1019408287 7:895350-895372 CCTCATGGGCTCCTCAGAGCAGG + Exonic
1019642154 7:2109279-2109301 TCTCATGGGCTGCTTAAGGCAGG - Intronic
1019849818 7:3543482-3543504 CCTCATGGTCTGCTCGTGGCTGG + Intronic
1022487972 7:30794930-30794952 CCTGAGGGTCTACTCAGGTCAGG - Intronic
1022533606 7:31082192-31082214 GCTGATGGGCTGATCCGGGACGG + Intronic
1022593548 7:31689436-31689458 CTTGTTGGGCTGCCCAGGGAAGG - Intronic
1026926087 7:74194913-74194935 CCTGATGGGATGATCATGGCCGG + Intronic
1026956397 7:74378984-74379006 CCTGATTAGCTGTTCAGGGCAGG + Intronic
1027501813 7:78961291-78961313 CTCGAGGGGCTGCACAGGGCAGG - Intronic
1032591232 7:133194071-133194093 CCCGAGGGGGTGCTGAGGGCAGG - Intergenic
1033630053 7:143148792-143148814 CCTGGTGGACTGATGAGGGCAGG - Intergenic
1034230971 7:149528209-149528231 CCTGATGGCCTGCTGAGGACTGG - Intergenic
1034259349 7:149745108-149745130 CCTCTTGGGGTGCTCAAGGCGGG + Intergenic
1034437454 7:151069978-151070000 CCTGGTGGGCCACTCCGGGCAGG - Exonic
1034498019 7:151433545-151433567 CCTGCTGGGGGACTCAGGGCAGG + Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1035412031 7:158652241-158652263 CTAGATGGGCTTTTCAGGGCTGG - Intronic
1035731789 8:1858660-1858682 CCAGAGGGACTGCTCAGGTCAGG + Intronic
1037313236 8:17577531-17577553 CCTGGTGGGCTCCTAAGGGTCGG - Intronic
1037643709 8:20771498-20771520 CCTGCTGGGCTTCTCTGGCCTGG + Intergenic
1037701053 8:21274069-21274091 CCAGGTGGGATGCTTAGGGCTGG - Intergenic
1038357550 8:26843454-26843476 CCACATGGGCTGATCAGGGTTGG + Intronic
1039581175 8:38667939-38667961 GCTGATGGGCTGCTCCAGACAGG + Intergenic
1041868491 8:62605327-62605349 GGTCATGGGCAGCTCAGGGCTGG - Intronic
1045507527 8:102789140-102789162 CCTGAAGGGAAGGTCAGGGCAGG + Intergenic
1047495089 8:125403567-125403589 CCTAAGGGGCCGCTCAGGGCTGG + Intergenic
1047933051 8:129749662-129749684 TCTGAAGGGCTTCCCAGGGCAGG - Intronic
1049221580 8:141431116-141431138 CCTGCTGGGCTGGGCAGAGCAGG - Exonic
1049392850 8:142381065-142381087 CCTGATTGGCTGCTGAGGCCTGG - Intronic
1049430007 8:142557770-142557792 CCTGAGGGGATGCTGGGGGCTGG - Intergenic
1049565396 8:143335375-143335397 TCTGAGGGGCTGCTGTGGGCTGG - Intronic
1050428764 9:5539774-5539796 CCTGAAGGCCTGGGCAGGGCAGG + Intronic
1051124997 9:13793392-13793414 CCTGATGGGCTTCTCTTGGTGGG - Intergenic
1051720143 9:20028642-20028664 CCTGATGGGCTCTGCAAGGCGGG - Intergenic
1052250806 9:26394641-26394663 CCTTAGGAGCTGTTCAGGGCTGG + Intergenic
1052864040 9:33454193-33454215 CCTCAAAGGCTGCTGAGGGCAGG - Intergenic
1053293347 9:36896586-36896608 CCTGATCTGCTTCTCAGGGAAGG - Intronic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1055649931 9:78397305-78397327 TCTGAGGGGAGGCTCAGGGCTGG - Intergenic
1056101984 9:83308552-83308574 GCTGATGGCCTGAGCAGGGCTGG + Intronic
1056890760 9:90489492-90489514 ACAGAAGGGCTGCTCAGTGCAGG - Intergenic
1057209606 9:93192616-93192638 CCAGAGGGGCTGCCCAGGACAGG + Intronic
1058718040 9:107739767-107739789 CCTTGTGGTCAGCTCAGGGCGGG - Intergenic
1061002643 9:127910956-127910978 TCTGATGGGGTGGTCAGGGCGGG + Intronic
1061651349 9:132052955-132052977 ACGAAAGGGCTGCTCAGGGCTGG + Intronic
1061873118 9:133531169-133531191 CCCGAGGGGCTGCTGGGGGCTGG + Intergenic
1061949119 9:133926373-133926395 CCTGCTGGGCTGCCGGGGGCTGG - Intronic
1061976499 9:134070569-134070591 GATGATGGGCTGCTAGGGGCTGG - Intergenic
1062158095 9:135065323-135065345 CTTGGTGGGCTGCCCTGGGCTGG - Intergenic
1062162993 9:135089983-135090005 CCTGTTAGGGGGCTCAGGGCTGG - Intronic
1062254141 9:135613255-135613277 ACTGAGGGGCTACTCTGGGCTGG - Intergenic
1062581073 9:137229495-137229517 CCTGGCGGGCTGCCCAGAGCAGG + Exonic
1062726561 9:138077328-138077350 CCAGGGTGGCTGCTCAGGGCAGG + Intronic
1186506873 X:10100673-10100695 CCCGAGGGGCTGCTCAGTGCAGG - Intronic
1187936712 X:24343398-24343420 CCTGATGGGCTGCTCTCTGAAGG - Intergenic
1190233948 X:48601895-48601917 CCTGGCCGGCTGCTCTGGGCGGG + Exonic
1191642391 X:63441614-63441636 CAGGAGTGGCTGCTCAGGGCTGG - Intergenic
1192171816 X:68860502-68860524 CCTGAGAGGCTGCTGTGGGCAGG - Intergenic