ID: 1078466770

View in Genome Browser
Species Human (GRCh38)
Location 11:11555775-11555797
Sequence CAGGCTATTCCACCTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078466770_1078466777 8 Left 1078466770 11:11555775-11555797 CCATGACCAGGTGGAATAGCCTG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1078466777 11:11555806-11555828 TGCATCTCTACCAGACCAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1078466770_1078466780 28 Left 1078466770 11:11555775-11555797 CCATGACCAGGTGGAATAGCCTG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1078466780 11:11555826-11555848 TGGACTCTGTCTCAAAGACATGG 0: 1
1: 0
2: 0
3: 40
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078466770 Original CRISPR CAGGCTATTCCACCTGGTCA TGG (reversed) Intronic
900090051 1:916296-916318 CTGTCTCTTCCCCCTGGTCAGGG + Intergenic
902291480 1:15438381-15438403 CAGGTGAGTGCACCTGGTCAAGG - Intergenic
905887976 1:41501927-41501949 CATGCTAATCCACCTGCTCCCGG - Intergenic
906832889 1:49052227-49052249 CTGATTATTCCCCCTGGTCATGG + Intronic
906957478 1:50387156-50387178 CAGGATATTCCACCACGCCAAGG + Intergenic
907147948 1:52253656-52253678 CAGTCTTTTCCAACTGCTCAGGG - Intronic
908123752 1:61009733-61009755 CAGGATATTCCACCATGCCAAGG + Intronic
908271163 1:62424044-62424066 CTGGCTTTTCCACGTGGTGATGG - Intergenic
910667086 1:89737311-89737333 TAGGCTATTCCACATAGTCTAGG - Intronic
911542587 1:99175947-99175969 CTGGATATTCCACCTGGTCTTGG + Intergenic
913331457 1:117671542-117671564 CAGGAGATTTCTCCTGGTCAGGG - Intergenic
915968130 1:160330142-160330164 CATGCTATTCCAGCTGATCAGGG - Intronic
916997681 1:170318273-170318295 AAAGCTATTCCACCTATTCAAGG - Intergenic
917364340 1:174213132-174213154 CAAACTATTCCAGCTGGGCATGG + Intronic
1067819122 10:49511213-49511235 CAGCCTTTCCCACCTGGTCCTGG - Intronic
1070806857 10:79275728-79275750 CAGGCTCTACCACCAGGGCATGG + Intronic
1075003882 10:118817036-118817058 CAGGCCCTTCCACCTGAGCAGGG + Intergenic
1075861568 10:125681247-125681269 CAGGCTAGTACAGCTGCTCAAGG - Intronic
1076352347 10:129825893-129825915 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1076352366 10:129825943-129825965 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1076531526 10:131148173-131148195 CAGGCTATTCCCCCATCTCAGGG - Intronic
1076693530 10:132236198-132236220 CAGGCTCTGCCACCTGGGGAAGG - Intronic
1077458753 11:2698357-2698379 AAGGCTATTTGACCTGCTCAGGG + Intronic
1078466770 11:11555775-11555797 CAGGCTATTCCACCTGGTCATGG - Intronic
1079237846 11:18702334-18702356 CAGACTCTTCCACCTGGTAGGGG - Exonic
1080832654 11:35910544-35910566 CATCCTCTTCCACCTGGTCTTGG + Intergenic
1083358049 11:62082354-62082376 CAGGATAATCCATCCGGTCAAGG + Intergenic
1084573493 11:69974388-69974410 CAGGCTGTTCCACCTGGTTTTGG + Intergenic
1085475362 11:76785457-76785479 CAGGAGATTCCTCCTGCTCATGG + Intronic
1085779723 11:79397162-79397184 AAGGCCATTCCAGCTAGTCATGG + Intronic
1087043640 11:93825847-93825869 CAGCCTTGACCACCTGGTCAAGG + Intronic
1087493355 11:98857165-98857187 TAGGATATTCCATTTGGTCATGG - Intergenic
1088358512 11:108967777-108967799 GGGGCTATTCCACATTGTCATGG + Intergenic
1092131666 12:6117396-6117418 CAGGCATTTCCACGAGGTCAGGG - Intronic
1094440488 12:30470594-30470616 CACCTTATTCCTCCTGGTCATGG - Intergenic
1094491242 12:30962230-30962252 CTGGCTCTTCCACCTGGTGGAGG + Intronic
1101530505 12:105569134-105569156 CAGGTTGTTCCACCTGGCCAAGG + Intergenic
1101725316 12:107383869-107383891 CAGGGTCTTCCATCTGCTCAGGG + Intronic
1103951567 12:124554349-124554371 CAGGCAGTTCCACATCGTCATGG + Intronic
1104411878 12:128565057-128565079 CAGGCTTTGCCACCTAATCATGG - Intronic
1105812594 13:24008356-24008378 CTGGCCATTCCAGCTGGACAAGG - Intronic
1114208904 14:20599138-20599160 CTGTCTACTCCACCTGGACAAGG + Intronic
1117735596 14:58765513-58765535 GAAGCCATTCCATCTGGTCATGG + Intergenic
1118048329 14:61997247-61997269 AAGGACATTCCACCTGGTTAAGG + Intronic
1119850391 14:77862451-77862473 CAGTCTCATCCACCTGGTCAGGG - Intronic
1122122370 14:99561377-99561399 CATGCCAGTCCAGCTGGTCACGG - Intronic
1128360362 15:66957445-66957467 CAGGCTATTTCACCTGGAGTAGG + Intergenic
1128520239 15:68370313-68370335 CAGGCTTTTCCTCCAGGGCACGG - Intronic
1131736859 15:95341971-95341993 TAGGCTATACCACGTGGTCGAGG - Intergenic
1132223320 15:100121753-100121775 CAGGCTTTTCTCCCTGGTCCTGG + Intronic
1133295399 16:4749461-4749483 CTGGCTCTGCCACCTGGGCAAGG + Exonic
1136245661 16:28974569-28974591 CAGGCGACTCCACCTAGTCACGG + Intronic
1138216654 16:55210624-55210646 AAGGCAATTCCACCAGATCAGGG - Intergenic
1138440517 16:57031903-57031925 CTGGCTATTCCAGCTGTGCATGG + Intronic
1141428626 16:83959387-83959409 CAGGCTGACCCACCTGGTCCAGG - Exonic
1141642192 16:85347816-85347838 CCTTCTGTTCCACCTGGTCAGGG + Intergenic
1143337383 17:6182413-6182435 TTGGCTATTCCATCTGGTCTGGG - Intergenic
1145988890 17:29066205-29066227 CAGGCTGCTCCACCTGTTCTCGG - Intergenic
1147348989 17:39825192-39825214 CAGACTAATACACCAGGTCATGG + Intronic
1147965939 17:44194191-44194213 CAGGCTATGCCACCTGGGTGGGG + Exonic
1148584513 17:48767918-48767940 CAAGCTATGCCGCCTGGTCTAGG - Intronic
1155044453 18:22091791-22091813 CAGGCTGTTCTACCTCGTCCTGG + Intronic
1156118245 18:33813081-33813103 GAGTAAATTCCACCTGGTCATGG - Intergenic
1157709726 18:49841949-49841971 CAGGCTTTTTCACCTAGTTAGGG - Intronic
1158952661 18:62509380-62509402 CCGGCTCTTCCACCTGGAAATGG - Intergenic
1165005090 19:32798375-32798397 CAGGCTCTGCCACCTGATCCTGG + Intronic
1166376687 19:42331345-42331367 CAGGGTCCTCCAGCTGGTCATGG + Intronic
938281423 2:130066167-130066189 CTGGCTGGTCCACCTGGTCCTGG + Intergenic
938332311 2:130456456-130456478 GTGGCTAGTCCACCTGGTCCAGG + Intergenic
938357496 2:130664212-130664234 GTGGCTAGTCCACCTGGTCCAGG - Intergenic
939800471 2:146700788-146700810 CTGACTATTCCTCATGGTCAGGG + Intergenic
942171946 2:173297821-173297843 CAAGCTGGGCCACCTGGTCAAGG + Intergenic
943213139 2:184994551-184994573 TAGGCTATTACACCTGGTTTAGG + Intergenic
1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG + Intronic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1172336707 20:34122607-34122629 CAAGCTGGGCCACCTGGTCAAGG + Intergenic
1173972176 20:47161512-47161534 CAAGCTGGGCCACCTGGTCAAGG - Intronic
1174482274 20:50839789-50839811 AGAGCTATTCCACCTGGCCAAGG + Intronic
1180099481 21:45577885-45577907 CAGGACAATCCACCTGCTCAGGG + Intergenic
1185140421 22:49097808-49097830 CAGGACATTGCTCCTGGTCAAGG + Intergenic
962815376 3:138992675-138992697 CAGGCTGTTCCCCCTGGCCAGGG + Intergenic
963310172 3:143700772-143700794 CTGGCTTTTCCACCTGCTGATGG + Intronic
969863425 4:10055575-10055597 CAGGATATTCAACCTTGCCAGGG - Intergenic
971243924 4:24912379-24912401 CAGGTAATTCCACCTGGCCCAGG + Intronic
974916656 4:68186012-68186034 CAGATTTTTCCACCTGGTGAAGG - Intergenic
979110860 4:116754194-116754216 CAGGCTTTTTCACATGGTGATGG + Intergenic
980442012 4:132861110-132861132 CAGGCTATACCACATAGTCTAGG + Intergenic
984492718 4:180456419-180456441 CAGTGTTTTCCATCTGGTCATGG + Intergenic
985362330 4:189188983-189189005 GATTTTATTCCACCTGGTCATGG - Intergenic
990953032 5:61317267-61317289 CAGGCAAAACTACCTGGTCATGG + Intergenic
992272774 5:75082588-75082610 AAGGCTATTCCATCTGATAAAGG + Intronic
998097786 5:139406652-139406674 CAGCCTGTTCCAGCTGGTGAAGG - Intergenic
1002288624 5:178182723-178182745 CAGCCAGTTGCACCTGGTCAGGG + Intergenic
1005428578 6:25729448-25729470 CAGTCTATTCCACTGGGTCTTGG + Intergenic
1006612732 6:35304338-35304360 GAGGATATTCCACCTGGTCAGGG + Intronic
1010315453 6:74443337-74443359 AAGGCCATTGCACCTGGCCATGG + Intergenic
1011274981 6:85622086-85622108 GAGGCTATTGCACCTGGCCCTGG - Intronic
1014222823 6:118815540-118815562 CAGGCTCTTCCACTTGCGCAAGG + Exonic
1017023289 6:150159124-150159146 CAGCCCTTTCCACCTGCTCAGGG + Intronic
1018178222 6:161197386-161197408 CATGTTATTCCATGTGGTCATGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024281774 7:47724581-47724603 CAGGCTGTTCCACCTGCTTCAGG - Intronic
1030651839 7:112124480-112124502 AAGGATATTCCACCCAGTCAAGG + Intronic
1043304087 8:78772327-78772349 CAGGCTATGTCATGTGGTCAGGG - Intronic
1043700856 8:83287389-83287411 CTGGCTTTTCCACCTGGTATAGG + Intergenic
1044006290 8:86940933-86940955 CAGGCTATACCAGCTGGCCTAGG + Intronic
1044843278 8:96356201-96356223 TAGGCTATTCCACATGGCCTGGG + Intergenic
1050506000 9:6350298-6350320 TAGGCTCTTCCTCCTAGTCAGGG - Intergenic
1050833378 9:10043435-10043457 CTGGCTATTACTCCTGGTAAAGG + Intronic
1057726408 9:97571661-97571683 CAGGCTATGCAACCTGCCCAAGG + Intronic
1059820504 9:117967330-117967352 CAGGTTATTCCAGCTGGGCATGG - Intergenic
1060235169 9:121857588-121857610 ATGACTATTCCACCTAGTCAGGG + Intronic
1186661164 X:11668488-11668510 CTATCTATTCCATCTGGTCATGG + Intergenic
1189268592 X:39735031-39735053 CTGGCTATGCCACCTTGTGAAGG - Intergenic
1192084704 X:68084709-68084731 CTGACAATTCCACCTGGACAGGG + Intronic
1199693964 X:150330416-150330438 CAGTCTGTTCCACTTGGCCAGGG - Intergenic