ID: 1078469225

View in Genome Browser
Species Human (GRCh38)
Location 11:11573742-11573764
Sequence GGTTTATTGAGACCATGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078469225_1078469232 24 Left 1078469225 11:11573742-11573764 CCTCATCATGGTCTCAATAAACC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1078469232 11:11573789-11573811 GCGTCGACGGTGACTTCCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 13
1078469225_1078469233 28 Left 1078469225 11:11573742-11573764 CCTCATCATGGTCTCAATAAACC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1078469233 11:11573793-11573815 CGACGGTGACTTCCCGAGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 34
1078469225_1078469229 11 Left 1078469225 11:11573742-11573764 CCTCATCATGGTCTCAATAAACC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1078469229 11:11573776-11573798 TGCCCATGCATGAGCGTCGACGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078469225 Original CRISPR GGTTTATTGAGACCATGATG AGG (reversed) Intronic
900774320 1:4570648-4570670 GGTTTCATGAGACAATGAAGAGG + Intergenic
905351772 1:37351980-37352002 GGTTTTTTCACAGCATGATGTGG + Intergenic
911866091 1:103024083-103024105 GTTTTATTATGATCATGATGAGG + Intronic
916392818 1:164350001-164350023 GGTCTATTGAGATAATCATGTGG - Intergenic
916747468 1:167695390-167695412 CCTTTCTTGAGACCATGATTGGG - Intronic
917309488 1:173663717-173663739 GGATAATTTAGACCATGAGGTGG + Intronic
919223529 1:194662844-194662866 AGTTTATTGAGAGTATGAAGGGG - Intergenic
919228612 1:194742314-194742336 GGTTTTTTGATATCATGAAGCGG + Intergenic
920011952 1:202874406-202874428 GGTTTATTGAGGCTAGCATGAGG - Intergenic
923989099 1:239414355-239414377 GGTTTATTGAAACCAAACTGAGG - Intronic
924261960 1:242240739-242240761 GGTTGATGGAGACAAGGATGTGG + Intronic
1063733919 10:8731039-8731061 GGCATATCGAGACCATGATGAGG + Intergenic
1064924045 10:20550599-20550621 GATGTAATGAGACTATGATGTGG + Intergenic
1069020436 10:63481711-63481733 AGTTTATTCAGACCATTTTGAGG + Intergenic
1070050211 10:72881559-72881581 TGTTTATTAACACCATGAAGAGG + Intronic
1070215577 10:74376571-74376593 GGTTTTTTGAGACCATTCTCAGG - Intronic
1076101459 10:127782875-127782897 CGTCTATTGAGATCATCATGTGG + Intergenic
1076167567 10:128294680-128294702 GGCTTATGGAGACCATCCTGAGG + Intergenic
1077811313 11:5640376-5640398 TGTCTATTGAGATCATCATGTGG + Intronic
1078469225 11:11573742-11573764 GGTTTATTGAGACCATGATGAGG - Intronic
1079044967 11:17093722-17093744 GATTGATTGATACCAGGATGTGG - Intronic
1079257216 11:18841746-18841768 CGTCTATTGAGATCATCATGTGG - Intergenic
1080018877 11:27537652-27537674 TATTTATTGAGACGATCATGTGG + Intergenic
1081343288 11:41953550-41953572 GGTTTAATTAGTCCTTGATGGGG - Intergenic
1082787058 11:57323051-57323073 GGATTATTGAGACCCTGAGGGGG + Intronic
1086909231 11:92452858-92452880 GGTTGCTTGAGACCAGGTTGTGG - Intronic
1086989560 11:93288072-93288094 GGTCTAGTGAGGCCATGAAGTGG + Intergenic
1087457323 11:98403432-98403454 GGTTTATTTAGCCAAGGATGAGG + Intergenic
1087487893 11:98781371-98781393 GTTTTATTAAAGCCATGATGGGG + Intergenic
1093783319 12:23162657-23162679 TGATTATTGAGACAATCATGTGG + Intergenic
1094084564 12:26575391-26575413 GGGTTAATGAGGCCACGATGCGG + Intronic
1095259116 12:40078393-40078415 TGTCTATTGAGATCATCATGTGG + Intronic
1095680638 12:44971429-44971451 GATTGATTGTTACCATGATGAGG + Intergenic
1098733699 12:74069898-74069920 TGTTTATTGAGAGAATCATGTGG - Intergenic
1104503095 12:129304503-129304525 GGATTGTTCAGGCCATGATGTGG - Intronic
1105825401 13:24118244-24118266 GGTAAAAAGAGACCATGATGGGG - Intronic
1106969063 13:35114093-35114115 GGTTTTTAGAAACCAAGATGTGG + Intronic
1107054440 13:36087996-36088018 TGTTTTTTAAAACCATGATGTGG + Intronic
1107370693 13:39744002-39744024 CGTTTATTGAGATAATCATGTGG - Intronic
1109882167 13:68494048-68494070 GCTTTTTTGGGACCATGATGAGG + Intergenic
1110847049 13:80201943-80201965 GGTGAAATGAGAGCATGATGTGG - Intergenic
1110998288 13:82141777-82141799 GCTTTTTTGAGAGAATGATGTGG + Intergenic
1111363482 13:87208407-87208429 AGTTTATTGAGTTCATGATTTGG + Intergenic
1115310155 14:31971187-31971209 GTTTTATTGAGACAATGATATGG + Intergenic
1117287118 14:54296732-54296754 GGGTTCTTGAAACCAAGATGAGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119092122 14:71793738-71793760 CATTTATTGAGATCATCATGTGG + Intergenic
1122239961 14:100357057-100357079 TGTTTATTGAGATGATCATGTGG - Intronic
1123413468 15:20078382-20078404 TGTTTATTGAGAAGATCATGTGG + Intergenic
1123522810 15:21085494-21085516 TGTTTATTGAGAAGATCATGTGG + Intergenic
1125622112 15:41072732-41072754 AGTTTTTTGAAACCATGATATGG + Intronic
1126712139 15:51470823-51470845 GGTTTTATCAGGCCATGATGAGG - Intronic
1127218410 15:56849621-56849643 AGTTTATTGAGACTGTTATGTGG - Intronic
1130366673 15:83246834-83246856 CATTTATTGAGACAATCATGTGG + Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1133451083 16:5904542-5904564 GGTGCATTCAGACCATGGTGTGG + Intergenic
1133685005 16:8158176-8158198 GCTTTATTGAATCCACGATGGGG + Intergenic
1134502657 16:14781209-14781231 ATTATCTTGAGACCATGATGGGG - Intronic
1134577906 16:15347686-15347708 ATTATCTTGAGACCATGATGGGG + Intergenic
1134724682 16:16409860-16409882 ATTATCTTGAGACCATGATGGGG - Intergenic
1134942749 16:18301999-18302021 ATTATCTTGAGACCATGATGGGG + Intergenic
1137239198 16:46640498-46640520 GGCTTTCTCAGACCATGATGAGG - Intergenic
1140568287 16:76070681-76070703 AGTTTATTGAGATGATCATGTGG + Intergenic
1145814253 17:27783979-27784001 GGTTTAGAGAGACTATGACGTGG - Intronic
1149125222 17:53221485-53221507 GGTCTATTGAGACGATCATATGG - Intergenic
1153423899 18:4941739-4941761 GGTTTATTGAGTTCATCAAGAGG + Intergenic
1154449706 18:14464093-14464115 GGTGTCTTGAGACCAGGAGGTGG - Intergenic
1155311487 18:24528570-24528592 GGTTTATTAAGACCCTGGAGAGG + Intergenic
1155491816 18:26407384-26407406 TGGTTATTTAGACCCTGATGAGG - Intergenic
1160225491 18:77008291-77008313 GCTTCACTGAGACCAAGATGGGG - Intronic
1161286492 19:3471150-3471172 GGTGTATTGAAACCATGTTGGGG - Intergenic
930920661 2:56749648-56749670 GGTTTATTTTGAACATGAAGAGG + Intergenic
932958612 2:76385960-76385982 GGTTTAATGAAACCATGATTAGG + Intergenic
933855270 2:86407619-86407641 TGTTTATTGAGACAATTATGTGG - Intergenic
933875968 2:86622806-86622828 GGTTTTTTGAGGCCATTGTGTGG - Exonic
935521750 2:104114969-104114991 GATTTCTTGAGACCAGGAGGTGG + Intergenic
940532820 2:154902074-154902096 GGTCTATTGAGACTATCATATGG + Intergenic
943059189 2:183020376-183020398 GATTGATTGAGACCAGGAGGTGG + Intronic
944463251 2:199974469-199974491 GGTTGAGTGAGACCATGTTCTGG - Intronic
947175591 2:227363935-227363957 GGTTTATTGAAACCAGTAGGAGG + Exonic
949079017 2:242081920-242081942 GGTTGCTTGAGCCCATGAGGTGG - Intergenic
1171539157 20:25931383-25931405 GATTTATTAAGTCCATGCTGTGG - Intergenic
1171842102 20:30226707-30226729 GATTTATTAAGTCCATGCTGTGG - Intergenic
1173777123 20:45718562-45718584 TGTTTATTGAGATAATCATGTGG - Intergenic
1177512297 21:22104447-22104469 TGTTTATTGAGATAATTATGTGG + Intergenic
1177734320 21:25070026-25070048 GGTTAAATGAGGCCATAATGGGG + Intergenic
1177763457 21:25429680-25429702 AGTTTATTGTGAAAATGATGGGG - Intergenic
1178340542 21:31782376-31782398 GGTTTATTAAGGACATAATGTGG - Intergenic
1179028546 21:37700536-37700558 AGTTTATTCTGACAATGATGAGG + Intronic
1179179861 21:39036014-39036036 GGGTTGTGGAGACCACGATGAGG - Intergenic
949717208 3:6947295-6947317 CGTTTATTGAGATAATAATGTGG + Intronic
951050180 3:18085196-18085218 GGTTAATTGAAACTATGAGGAGG - Intronic
951871842 3:27370320-27370342 CGTTTAGTGATACCAAGATGAGG - Intergenic
952572676 3:34735749-34735771 TGTTTATTGAGATAATAATGTGG - Intergenic
953113701 3:39969564-39969586 GGTCTATTGAGATAATCATGTGG + Intronic
955232903 3:57114606-57114628 GGTTCCTGGAGACCATCATGTGG + Intronic
956368538 3:68532943-68532965 GGTTTATTTTGCCAATGATGAGG + Intronic
958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG + Intergenic
959497710 3:107070731-107070753 AGTTTATTGAGCTCATGATTCGG - Intergenic
964462877 3:156955587-156955609 CATTTATTGAGATCATCATGTGG + Intronic
966811710 3:183852071-183852093 GGTTGTTTGAGACCAGGTTGAGG + Intronic
967470972 3:189861486-189861508 GGTTTATTGAGGACTTTATGAGG - Intronic
971818884 4:31526605-31526627 CGTTTATTGAGAAGATCATGTGG + Intergenic
972204806 4:36759090-36759112 GGTTTGTTGAGACAAAGTTGAGG - Intergenic
972989795 4:44810850-44810872 CATTTATTGAGACAATCATGTGG + Intergenic
973975969 4:56262877-56262899 GGTATATTCAGACCCTCATGGGG - Intronic
974342196 4:60628596-60628618 CGTTTATTGAGATAATCATGTGG + Intergenic
975753207 4:77545990-77546012 CCTCTATTGAGATCATGATGTGG + Intronic
978940596 4:114431749-114431771 TGTCTATTGAGATCATCATGTGG + Intergenic
979539353 4:121863255-121863277 GGTTATTGGAGATCATGATGGGG - Exonic
980090562 4:128438715-128438737 TGTCTATTGAGATGATGATGTGG + Intergenic
981762147 4:148206383-148206405 GCTTCTTTGAGACAATGATGGGG - Intronic
981861116 4:149357487-149357509 CGTCTATTGAGATCATCATGCGG + Intergenic
984076040 4:175181146-175181168 GGTCTATTGAGATAATCATGTGG + Intergenic
984858731 4:184218234-184218256 GTTTAAATGAGGCCATGATGTGG - Intronic
987209349 5:15663564-15663586 TGTCTATTGAGATAATGATGTGG + Intronic
987564086 5:19562516-19562538 GATTTATTGTGACCTTGGTGAGG - Intronic
987620009 5:20328643-20328665 GGTTTATTTAGCCAAAGATGAGG - Intronic
988631415 5:32935618-32935640 GTTTTATTCAGCACATGATGTGG - Intergenic
989034194 5:37152413-37152435 GGTTAAATGAGACCATGGTTGGG - Intronic
990037309 5:51337240-51337262 GGTTTCTTGAGATCATGAGATGG + Intergenic
993089836 5:83411660-83411682 TGTCTATTGAGATAATGATGTGG - Intergenic
993738193 5:91503016-91503038 GATTTATTGAAACCATGTTTTGG + Intergenic
993869321 5:93232648-93232670 GGCTTATGGAGACCATCAAGTGG + Intergenic
994618770 5:102137860-102137882 AGTTTATTGAGACCAGGAAATGG + Intergenic
995135842 5:108679020-108679042 GTTTCCTTGAGACCATGTTGGGG + Intergenic
997959548 5:138309195-138309217 AGTTTGTTGAGAGCCTGATGTGG - Intronic
1000074329 5:157770820-157770842 GCCTTAATGAGACCATGAGGAGG - Intergenic
1002420237 5:179142405-179142427 GGTGTATTGAGACCTTCAGGAGG - Intronic
1002980740 6:2134474-2134496 GTGCTATTGAGACCAAGATGTGG - Intronic
1004031201 6:11871097-11871119 GGATCGTTGAGCCCATGATGGGG - Intergenic
1005190748 6:23220306-23220328 GCTTTATTGAGACCAAGAGTTGG + Intergenic
1006240741 6:32676071-32676093 TGTCTATTGAGACAATCATGTGG + Intergenic
1009692746 6:67057700-67057722 GGTCTATTGAGAGGATCATGTGG + Intergenic
1009810728 6:68661846-68661868 GCCTTAATGGGACCATGATGAGG + Intronic
1010790849 6:80063350-80063372 GGTTGGTTGAATCCATGATGTGG - Intergenic
1011028716 6:82897789-82897811 CGTTAATTGCGACCATGTTGAGG + Intronic
1015771224 6:136770163-136770185 ATTTTTTTGAGACCATGTTGGGG + Intronic
1017392387 6:153955356-153955378 CGTCTATTGAGATCATCATGTGG - Intergenic
1018813054 6:167311654-167311676 GGGTTAAAGAGACCAGGATGTGG - Intronic
1019423806 7:963773-963795 GGTTGTTTGGGACCAAGATGGGG + Intronic
1023412023 7:39897606-39897628 GGGTTATTGTCACCATTATGAGG - Intergenic
1023452743 7:40304845-40304867 TGTCTATTGAGACAATCATGTGG - Intronic
1024408693 7:49013677-49013699 TGTTTATTGAGATAATCATGTGG - Intergenic
1024851129 7:53718499-53718521 GATCTATTGAGACCATCATAGGG + Intergenic
1025699305 7:63802035-63802057 GGATTATTGTGACTATGAAGTGG + Intergenic
1026321247 7:69269231-69269253 GATTTCTTGAGCCCAGGATGGGG + Intergenic
1028649128 7:93130759-93130781 TTTTTATTGATACCAAGATGAGG + Exonic
1029968942 7:104770398-104770420 TCTTTATTGAGACCATGAGCAGG - Intronic
1030234662 7:107245112-107245134 GGTCTATTGAGATAATCATGTGG - Intronic
1033431259 7:141291804-141291826 GTCTTGTTGAGACCATCATGAGG + Intronic
1033859775 7:145610193-145610215 GGGTCATTTAGACCATGTTGAGG + Intergenic
1033974930 7:147089277-147089299 GGATTATGGAGACAATGAAGTGG - Intronic
1038768949 8:30458234-30458256 GGTTGGTTGAATCCATGATGTGG + Intronic
1043247122 8:78018169-78018191 GGTTAATTTAGACCTGGATGAGG - Intergenic
1044192176 8:89332073-89332095 GGTTTATAGGGAACATGATTTGG - Intergenic
1045424082 8:102045919-102045941 TGTTTATTGAGCCTATAATGTGG + Intronic
1046159689 8:110344392-110344414 TGTGTATTGATACAATGATGTGG + Intergenic
1047743736 8:127828055-127828077 GCTTTATTGATCCCATGGTGAGG + Intergenic
1048337969 8:133517111-133517133 ACTTTATTGAAACCATTATGGGG + Intronic
1048362005 8:133705467-133705489 CATTTATTGAGATCATCATGTGG - Intergenic
1049165740 8:141124648-141124670 AGTTTATTGAGGGCTTGATGGGG - Intronic
1051566505 9:18505029-18505051 GGTTTATGGAGAACATTTTGTGG + Intronic
1052097984 9:24408282-24408304 CGTATATTGAGACCAGTATGAGG + Intergenic
1052421198 9:28245204-28245226 CGTTTATTGAGACGATCATGTGG - Intronic
1052628674 9:31008655-31008677 CGTCTATTGAGATCATCATGTGG - Intergenic
1054165892 9:61728063-61728085 GATTTATTAAGTCCATGCTGTGG + Intergenic
1055676309 9:78665378-78665400 GTATTATTGATAGCATGATGTGG + Intergenic
1058087707 9:100766961-100766983 GGTTTATTGAGGTAATCATGTGG + Intergenic
1058698159 9:107577180-107577202 GGATTATGGTGACCCTGATGCGG - Intergenic
1059293456 9:113248408-113248430 GATTTCCTGAGACCATGAAGTGG - Intronic
1060302596 9:122383958-122383980 GATTTATTGAGATCATGAATGGG + Intronic
1186659496 X:11654830-11654852 GTTTTATTGAAAACAAGATGTGG + Intronic
1187600080 X:20819357-20819379 TGTCTATTGAGACAATTATGTGG - Intergenic
1189180518 X:39000275-39000297 GGACTATTGAGAGGATGATGTGG - Intergenic
1189429243 X:40932539-40932561 AGTTTTTTGAGACCATGGTCAGG + Intergenic
1190929487 X:54935393-54935415 TGTTTTTTGAGACCCTGCTGTGG + Intronic
1192866257 X:75135728-75135750 TGTTTATTGAGATGATCATGTGG - Intronic
1193018808 X:76767585-76767607 GGTTTATGGAGACAATTATGAGG + Intergenic
1193557793 X:82977483-82977505 TGTTTATTGAGAGAATCATGTGG - Intergenic
1193999352 X:88408644-88408666 GGTTTATTGTGTTGATGATGTGG - Intergenic
1194436892 X:93877587-93877609 TGTTTATTGAGATAATCATGTGG - Intergenic
1194547904 X:95260882-95260904 AGTTTATTGAGAGCATGAAGCGG - Intergenic
1194867774 X:99089747-99089769 CTTATATTGAGATCATGATGTGG - Intergenic
1196459546 X:115916289-115916311 GGTCTATTGAGATCGTCATGTGG - Intergenic
1199221698 X:145323504-145323526 CATCTATTGAGATCATGATGTGG - Intergenic
1201649650 Y:16271329-16271351 AGTTTATTGAGATGATCATGTGG + Intergenic
1202150856 Y:21842536-21842558 GGTGTTTTGAGACCATGAGGTGG + Intergenic