ID: 1078470158

View in Genome Browser
Species Human (GRCh38)
Location 11:11580149-11580171
Sequence AGGTCACAATGGTGAGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078470158_1078470165 9 Left 1078470158 11:11580149-11580171 CCACTAACTCACCATTGTGACCT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1078470165 11:11580181-11580203 CACATTCCATGTTTGGGTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1078470158_1078470162 2 Left 1078470158 11:11580149-11580171 CCACTAACTCACCATTGTGACCT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1078470162 11:11580174-11580196 GGCCTGTCACATTCCATGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 70
1078470158_1078470163 3 Left 1078470158 11:11580149-11580171 CCACTAACTCACCATTGTGACCT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1078470163 11:11580175-11580197 GCCTGTCACATTCCATGTTTGGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078470158 Original CRISPR AGGTCACAATGGTGAGTTAG TGG (reversed) Intronic