ID: 1078470158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:11580149-11580171 |
| Sequence | AGGTCACAATGGTGAGTTAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 133 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 9, 4: 122} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1078470158_1078470165 | 9 | Left | 1078470158 | 11:11580149-11580171 | CCACTAACTCACCATTGTGACCT | 0: 1 1: 0 2: 1 3: 9 4: 122 |
||
| Right | 1078470165 | 11:11580181-11580203 | CACATTCCATGTTTGGGTCCAGG | 0: 1 1: 0 2: 1 3: 8 4: 143 |
||||
| 1078470158_1078470162 | 2 | Left | 1078470158 | 11:11580149-11580171 | CCACTAACTCACCATTGTGACCT | 0: 1 1: 0 2: 1 3: 9 4: 122 |
||
| Right | 1078470162 | 11:11580174-11580196 | GGCCTGTCACATTCCATGTTTGG | 0: 1 1: 0 2: 1 3: 12 4: 70 |
||||
| 1078470158_1078470163 | 3 | Left | 1078470158 | 11:11580149-11580171 | CCACTAACTCACCATTGTGACCT | 0: 1 1: 0 2: 1 3: 9 4: 122 |
||
| Right | 1078470163 | 11:11580175-11580197 | GCCTGTCACATTCCATGTTTGGG | 0: 1 1: 0 2: 1 3: 9 4: 127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1078470158 | Original CRISPR | AGGTCACAATGGTGAGTTAG TGG (reversed) | Intronic | ||