ID: 1078470296

View in Genome Browser
Species Human (GRCh38)
Location 11:11580973-11580995
Sequence CAGGCTTCAGGGTGGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078470296_1078470303 9 Left 1078470296 11:11580973-11580995 CCACGGTGCCACCCTGAAGCCTG 0: 1
1: 0
2: 6
3: 42
4: 286
Right 1078470303 11:11581005-11581027 TCCCTGCGGCCGTTGGAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
1078470296_1078470300 -5 Left 1078470296 11:11580973-11580995 CCACGGTGCCACCCTGAAGCCTG 0: 1
1: 0
2: 6
3: 42
4: 286
Right 1078470300 11:11580991-11581013 GCCTGCTTCACAGCTCCCTGCGG 0: 1
1: 0
2: 5
3: 58
4: 366
1078470296_1078470302 2 Left 1078470296 11:11580973-11580995 CCACGGTGCCACCCTGAAGCCTG 0: 1
1: 0
2: 6
3: 42
4: 286
Right 1078470302 11:11580998-11581020 TCACAGCTCCCTGCGGCCGTTGG 0: 1
1: 1
2: 0
3: 15
4: 168
1078470296_1078470305 10 Left 1078470296 11:11580973-11580995 CCACGGTGCCACCCTGAAGCCTG 0: 1
1: 0
2: 6
3: 42
4: 286
Right 1078470305 11:11581006-11581028 CCCTGCGGCCGTTGGAAAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078470296 Original CRISPR CAGGCTTCAGGGTGGCACCG TGG (reversed) Intronic
900635802 1:3664385-3664407 CAGGGTTGGGGGTGGCACCTGGG + Intronic
902335195 1:15750464-15750486 CAGGCATCAGGCTGGCACTGGGG + Intergenic
902740864 1:18437049-18437071 CAGGAATCAGGGTGGCATCGAGG - Intergenic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
905034502 1:34908764-34908786 CAGGCTCCAGGGTGGGCCAGGGG - Intronic
907928093 1:58973521-58973543 CATGCTTCAGGGTGTCAGAGGGG + Intergenic
907928116 1:58973676-58973698 CATGCTTCAGGATGTCACAGGGG - Intergenic
908803689 1:67907699-67907721 CAGGCTTCGGGCTGGTACTGGGG + Intergenic
909395864 1:75169921-75169943 CAGGCTTCATGGTGCTACCCTGG + Intergenic
910459946 1:87437988-87438010 CTGGTTTCAAGGTGGCACCAAGG + Intergenic
910708452 1:90154631-90154653 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
911475405 1:98367141-98367163 CAGGCTTCAGGCTGTAACTGTGG + Intergenic
912456683 1:109802834-109802856 CGGCCTTCAGGGTGGCAGAGGGG - Intergenic
913339671 1:117746647-117746669 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
914049863 1:144122625-144122647 CAGACTTCACGCTGGCACCCAGG + Intergenic
914129319 1:144842826-144842848 CAGACTTCACGCTGGCACCCAGG - Intergenic
914317166 1:146524253-146524275 CTGGTTTCAAGGTGGCACCAAGG + Intergenic
914497189 1:148209107-148209129 CTGGTTTCAAGGTGGCACCAAGG - Intergenic
915999859 1:160605471-160605493 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
916713927 1:167434560-167434582 CAGGGTTCAGGGTCACACCCAGG + Intronic
918440447 1:184561290-184561312 AAGGCTTCAGGGTGGAGCCAGGG + Intronic
919549433 1:198966207-198966229 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
920217630 1:204372496-204372518 CAGGCTTTAGGATGGCATCTTGG + Intronic
922395945 1:225201664-225201686 CAGGCTCCAGGCTGGTACCGGGG + Intronic
922673327 1:227531997-227532019 CCGGCTTCAGGCTGGTACTGGGG + Intergenic
922790097 1:228306523-228306545 ACGGCTTCAGGGCTGCACCGCGG + Exonic
923490190 1:234478027-234478049 CAGGCTTTAGGGGAGCAACGCGG + Intronic
1062817772 10:513567-513589 CAGGCTGCAGTGTGGCGCAGTGG - Intronic
1062883350 10:996774-996796 ACGGCTCCAGGGTGGCACCCCGG - Intronic
1063088745 10:2842687-2842709 CAGGCTTGATGGTGGAACCAAGG - Intergenic
1063561234 10:7130125-7130147 CAGGCTCCAGGCTGGAACTGGGG + Intergenic
1063679306 10:8171969-8171991 CAGGCTTCAAGGTGGCCCCCAGG + Intergenic
1068610323 10:59052820-59052842 CAGGCATCAAGGTGGCACTAGGG - Intergenic
1069956917 10:72057579-72057601 CTGGCTGCAGGCTGGCACCGGGG + Intergenic
1070547801 10:77466126-77466148 CAGGCTTCAGAGGGGCAGAGAGG - Intronic
1070753964 10:78980279-78980301 TGGGCTTCAGGCTGGCACCGGGG + Intergenic
1072811734 10:98467655-98467677 CTGACTTCGGGGTGGCACCCAGG + Intronic
1072885242 10:99266840-99266862 CGGGCTTCAGGCTGGTACTGGGG - Intergenic
1073737733 10:106368695-106368717 CATGCTTCAGGCTGGAACCAGGG + Intergenic
1075946865 10:126440731-126440753 CAGGCTCCAGGCTGGTACTGGGG - Intronic
1076403229 10:130196744-130196766 CAGGCCACAGTGTGGCACCAAGG + Intergenic
1076596851 10:131628590-131628612 CAGGCTTCAGTGTGGATCCCGGG - Intergenic
1077018992 11:409228-409250 CAGGCATCATGGTGTCACCAGGG - Intronic
1077492556 11:2868858-2868880 TATGCTTCAGGGTGCCTCCGAGG - Intergenic
1078470296 11:11580973-11580995 CAGGCTTCAGGGTGGCACCGTGG - Intronic
1080923438 11:36731510-36731532 CAGGCTCCAGGCTGGTAGCGGGG - Intergenic
1081809696 11:45907904-45907926 CAGGCTTCAGGAGGGCAGGGAGG + Intergenic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1082773893 11:57231023-57231045 CAGGCTCCAGGCAGGCACCGTGG + Intergenic
1084323273 11:68385240-68385262 CAGGGTTCAGAGTGGCACTTAGG - Intronic
1084952403 11:72673971-72673993 CAGGCTGCAGTCTGGCAACGCGG + Intronic
1085917215 11:80903830-80903852 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1086375051 11:86191550-86191572 CAGGCTTCAGAGTGGCTCCGGGG + Intergenic
1089539871 11:119183340-119183362 AAGGATTAAGGGTGGCACCCCGG - Exonic
1089605665 11:119639953-119639975 CAGGCTCCTGGCGGGCACCGTGG - Intronic
1089695040 11:120211529-120211551 CAGGCTTGAAGGTGCCACCCCGG - Intronic
1090013240 11:123062854-123062876 CCGGCTTCAGGGTGCCACTAGGG + Intronic
1090375063 11:126282811-126282833 CAGGTTTCAGGTTGTCACGGTGG + Intergenic
1090629487 11:128633655-128633677 CAGGCTTCAGGTTATCCCCGGGG - Intergenic
1090709618 11:129373548-129373570 CAGGTGTCCGGGTGGCGCCGGGG - Intergenic
1091271431 11:134314333-134314355 CAGGCTTCCAGGTGGCAGAGCGG - Exonic
1091698838 12:2646557-2646579 CAGGCTTCAGTGGGGCAGGGAGG - Intronic
1093409201 12:18844893-18844915 CAGGCTCCAGGCTGGTACTGAGG + Intergenic
1096648165 12:53049257-53049279 CAGGCTTCGGGGTTGCCGCGGGG + Intronic
1101334602 12:103785093-103785115 CAGGCTTCAGTGTGGAAGTGAGG + Intronic
1102386722 12:112516310-112516332 CAGGGTTCAGGGTTGCAACGTGG + Intergenic
1103340695 12:120219709-120219731 CAGGGTACAGTGTGGCAGCGGGG + Intronic
1103356609 12:120326099-120326121 CAGGGGTCAGGGAGGCAGCGTGG - Intronic
1104255073 12:127129029-127129051 CAGGCTTCAGGCTGTAACCCTGG + Intergenic
1105378018 13:19863054-19863076 CCGGCGGCAGGGTGGCAGCGCGG + Intronic
1105542325 13:21326382-21326404 CAGGCTTCAGGGGAGCACTCGGG - Intergenic
1106298515 13:28440406-28440428 CAGCCTTCAGGGTGCCGCCAGGG - Intronic
1106392183 13:29345955-29345977 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1106978081 13:35246584-35246606 CAGGCTCCAGGCTGGTACTGAGG + Intronic
1107688351 13:42926782-42926804 CAGACTTCAGGGTGGAGCTGTGG + Intronic
1108045337 13:46378681-46378703 TAGGCATCATGGTGGCACTGAGG - Intronic
1108134283 13:47338620-47338642 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1108362029 13:49676659-49676681 CAGGCCTAGAGGTGGCACCGAGG - Intronic
1109279740 13:60342142-60342164 CAGGATTCAAGGTGCCACCTTGG + Intergenic
1109687886 13:65844467-65844489 CAGGCTTCAAGATGCCACCGCGG + Intergenic
1113905689 13:113818201-113818223 CAGGCTCCAGCCCGGCACCGCGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115642119 14:35341586-35341608 CAGGATTCAGGGTCTCACCAAGG - Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116916774 14:50532691-50532713 CAGGCCTCAGGGCGGCACTCTGG - Intronic
1118096652 14:62545254-62545276 CAGGTTTCAGGGTGGCAAAGTGG + Intergenic
1119725761 14:76920903-76920925 CAGGCTGCAGGGTGGTGCCCGGG + Intergenic
1119765303 14:77183932-77183954 CAGGCCTCAGAGAGGCCCCGTGG + Intronic
1120224685 14:81777440-81777462 GAGGCTTCAAGTTGGCACAGTGG - Intergenic
1122649886 14:103220550-103220572 CAGGCCTCAGGGACGCATCGGGG + Intergenic
1122715703 14:103695808-103695830 CTGGCTTCAGGGAGGCCCCCTGG - Intergenic
1123419731 15:20121874-20121896 CAGACTTCAGGGTGGCACCCAGG + Intergenic
1123446133 15:20331662-20331684 CAGACTTCAGGGTGGCACCCAGG - Intergenic
1123528954 15:21128410-21128432 CAGACTTCAGGGTGGCACCCAGG + Intergenic
1125269344 15:37921268-37921290 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1125501291 15:40241540-40241562 CAGGCTTGGAGGTGGCACCTGGG + Intronic
1126709893 15:51443769-51443791 CAGGCTCCAGGATGGCCCCAAGG - Intergenic
1127860505 15:62989911-62989933 GAGGCTTCAGGGTGGTAAGGAGG - Intergenic
1128866596 15:71119300-71119322 CAGGCTCCAGGGTGGAAGCAGGG + Intronic
1129120560 15:73393948-73393970 CAAGCTGCAGGGAGGCACAGAGG + Intergenic
1129562711 15:76589038-76589060 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1129675476 15:77630877-77630899 GAGGGTATAGGGTGGCACCGGGG - Intronic
1129689380 15:77704850-77704872 CAGGGTTCAGGGTGGGACCAGGG - Intronic
1129982570 15:79887584-79887606 CAGGCTTAATGGTGGAACCCAGG - Intronic
1131180034 15:90233467-90233489 GAGGCCCCAGCGTGGCACCGCGG - Intronic
1132701651 16:1224704-1224726 CAGGCCTCAGGGCGGCACTGGGG + Intronic
1132810223 16:1793666-1793688 CAGGCTGCAGGCAGGCAGCGAGG + Exonic
1133128012 16:3658715-3658737 CTGCCTTCAGGGTGGAACAGCGG - Exonic
1136720629 16:32317012-32317034 CAGACTTCAGGCTGGCACCCAGG + Intergenic
1136839009 16:33523294-33523316 CAGACTTCAGGCTGGCACCCAGG + Intergenic
1138412206 16:56849564-56849586 CAGGCTTTCAGGTGGCACCCAGG + Intronic
1139520718 16:67481247-67481269 CCGGCTTCCGGGTGGCTGCGCGG + Intergenic
1141297326 16:82782220-82782242 CAGGATTCAGGGTGGGCCTGTGG + Intronic
1141670895 16:85491224-85491246 CAGGCCTCTGGGTGCCACCTGGG + Intergenic
1142173143 16:88633307-88633329 CAGGCTGCAGGCTGGCACCCAGG - Intergenic
1203005803 16_KI270728v1_random:200758-200780 CAGACTTCAGGCTGGCACCCAGG - Intergenic
1203137353 16_KI270728v1_random:1736878-1736900 CAGACTTCAGGCTGGCACCCAGG - Intergenic
1203149172 16_KI270728v1_random:1823581-1823603 CAGACTTCAGGCTGGCACCCAGG + Intergenic
1142995469 17:3757437-3757459 CAGGACTCAGCTTGGCACCGCGG + Intronic
1143449617 17:7027966-7027988 GAGGCCTTTGGGTGGCACCGGGG + Exonic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1149370632 17:55990719-55990741 GAGACTTCAGAGTGGCTCCGTGG - Intergenic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1151759331 17:76091628-76091650 CTGGCTTCAGGGTGCCCCCCAGG - Intronic
1151827585 17:76531733-76531755 GAAGCTTCAGGGTGGGCCCGAGG - Intronic
1152057648 17:78043271-78043293 CAGGCCACAGTGTGGCCCCGAGG + Intronic
1152209666 17:78996389-78996411 CAGGCTTTGGGGAGGCACGGTGG - Intronic
1152684713 17:81688359-81688381 CAGGCCTGACGGTGGCAGCGTGG - Intronic
1153079838 18:1210051-1210073 CAGGCTCCAGGATGGTACTGGGG + Intergenic
1153396321 18:4625495-4625517 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1153400544 18:4679447-4679469 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1154300202 18:13185532-13185554 CAGGCTTCAACATGGGACCGTGG - Intergenic
1155930044 18:31697442-31697464 CAGACATCTGGGTGGCAGCGAGG + Intergenic
1156944727 18:42814863-42814885 CAGGCTCCAGGCTGGTACTGGGG - Intronic
1157025315 18:43835892-43835914 AAGGCTACAGGGTGGCATCCTGG + Intergenic
1157795937 18:50575224-50575246 CAGGGTTCAAGGTGTCACCTTGG + Intronic
1160018351 18:75161322-75161344 CAGTCTTCTAGGTGGCACTGAGG + Intergenic
1161103373 19:2432226-2432248 CAGGCTCCAGGGAGGCCCAGTGG + Intronic
1161120057 19:2520765-2520787 CAGGCCTCTGGGTGGCAGCAGGG + Intronic
1161303828 19:3556320-3556342 GAGGGTTCAGGGTGGCCCGGGGG + Intronic
1161707576 19:5829325-5829347 CAAGCATCAAGGTGACACCGTGG - Intergenic
1161729013 19:5947490-5947512 AGGGCTTCAGGATGACACCGGGG + Intronic
1162740433 19:12770778-12770800 TAGGGCTCAGGGTGGCACTGTGG + Intronic
1162907241 19:13831253-13831275 CAGGCTTCTGGGTGGCAGTATGG - Exonic
1164574196 19:29396195-29396217 CAGCCTCTAGGGTGGCACCCAGG + Intergenic
1165792902 19:38502739-38502761 CAGGCTTCAGGGTGGGGCAGGGG + Intronic
1167456591 19:49599537-49599559 CAGGCCTCGGGCTGGCACAGAGG - Exonic
1167879476 19:52444300-52444322 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1202689252 1_KI270712v1_random:75188-75210 CAGACTTCACGCTGGCACCCAGG + Intergenic
925871798 2:8278183-8278205 CAGGCCTCAGGGTGCCAGCCTGG - Intergenic
927420472 2:22925626-22925648 CAGGTGTCAGGGTGGCCCAGTGG - Intergenic
929010214 2:37434697-37434719 CAGGCTCTAGGCTGGTACCGGGG + Intergenic
929626869 2:43418419-43418441 CAGGACTCAGGGTGGCACAGAGG - Intronic
931136924 2:59413866-59413888 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
931419658 2:62114873-62114895 CAGATTTCAGGCTGGCAGCGAGG + Intronic
932984972 2:76714863-76714885 CAGGCTTCAGAGTGCCAAAGAGG - Intergenic
933957184 2:87380903-87380925 CAGACTTCAGGCTGGCACCCAGG - Intergenic
934241302 2:90272795-90272817 CAGACTTCAGGCTGGCACCCAGG - Intergenic
934271872 2:91543891-91543913 CAGACTTCAGGCTGGCACCCAGG + Intergenic
934957471 2:98634701-98634723 CAGTCTTCAGGGTGCCTCCCAGG + Intronic
935681029 2:105637104-105637126 TGAGCTTCAGGGTGGCACAGGGG - Intergenic
936147859 2:109993502-109993524 CAGACTTCAGGCTGGCACCCAGG + Intergenic
936196832 2:110377945-110377967 CAGACTTCAGGCTGGCACCCAGG - Intergenic
936554978 2:113488207-113488229 CAGGCTCCAGGCTGGTACTGGGG - Intronic
937722994 2:125125848-125125870 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
938070017 2:128303353-128303375 CAGCCCTCAGGGTGGCCCCATGG - Intronic
939777637 2:146406146-146406168 CAAGCTGCAGGGCGGCAGCGAGG + Intergenic
940299883 2:152165580-152165602 CAGGCTTCAGGGGGGTGGCGCGG + Intronic
941593785 2:167451494-167451516 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
942154667 2:173115713-173115735 CAGGCTCCAGGCTGGTACTGGGG + Intronic
943129748 2:183840376-183840398 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
943654335 2:190491499-190491521 CAGGCTCCAGGCTGGTACTGGGG - Intronic
943862248 2:192882220-192882242 CAGGTTTCAAGGTGGCTCCATGG - Intergenic
944437358 2:199704565-199704587 CAGGACTCAAGGTGGCACCTTGG + Intergenic
946339961 2:219060551-219060573 CAGGCGTCCGGGTGGCTCCGGGG + Intergenic
946811594 2:223531092-223531114 CAGGCCCCATGGTGGCACCCAGG - Intergenic
948631085 2:239303097-239303119 CAGGGTTCAGGGTGGGCCCCTGG + Intronic
948714040 2:239847463-239847485 CAGGCTCCAAGCTGGTACCGGGG - Intergenic
948872703 2:240811727-240811749 CAGGCTCAAGGGTGGCAGGGAGG + Intronic
1169056403 20:2625038-2625060 TAGGCATTAGGCTGGCACCGGGG - Intronic
1170541040 20:17388253-17388275 GAAGCTTCAGGGTGGCAGGGAGG + Intronic
1170727543 20:18943224-18943246 CAGGCTCCAGGTTGGTACTGGGG + Intergenic
1170741110 20:19057285-19057307 CAGGCTCCAGGCTGGTACGGGGG - Intergenic
1171240488 20:23563564-23563586 CAGCCTTCAGGCTGGCACCATGG - Intergenic
1171349336 20:24490803-24490825 CAGGCTCCAGGGCAGCACAGAGG + Intronic
1171383613 20:24752358-24752380 CAGGCTCCAGGGTGGCCCTGGGG - Intergenic
1172689340 20:36779519-36779541 GTGGCTTAAGGGTGGCACCGGGG + Exonic
1173193755 20:40896710-40896732 CAGGCAACAGGGTGGCATGGAGG + Intergenic
1173664498 20:44754850-44754872 CAGGCTTCTGGGTGCCTCCCAGG + Intronic
1175318655 20:58070162-58070184 GAGGTCTCAGGGTGGCACTGAGG - Intergenic
1178173688 21:30072683-30072705 AAGGCCAGAGGGTGGCACCGTGG + Intergenic
1178959105 21:37047703-37047725 CCGGCTCCAGGCTGGCACTGGGG - Intergenic
1179467771 21:41589182-41589204 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1180552171 22:16549426-16549448 CAGATTTCAGGCTGGCACCCAGG - Intergenic
1180787682 22:18556160-18556182 CAGGCTCCTGGGTGGCCCTGCGG - Intergenic
1181234057 22:21439146-21439168 CAGGCTCCTGGGTGGCCCTGCGG + Intronic
1181244590 22:21495685-21495707 CAGGCTCCTGGGTGGCCCTGCGG - Intergenic
1181351860 22:22264633-22264655 CAGACTTCAGGCTGGCACCCAGG + Intergenic
1183688554 22:39375646-39375668 CAGGCATCAGGGGTGGACCGGGG + Intronic
950046734 3:9952527-9952549 CAGGGCTCAGAGTGGAACCGAGG + Intergenic
950599145 3:14016745-14016767 CAGGCTCCAGGCTGGTACTGTGG + Intronic
951711323 3:25586852-25586874 CAGGCTTCAGCGTTGCGCCTGGG + Intronic
952377593 3:32780574-32780596 CAGGCTCCAGGGTGGGAGTGGGG + Intergenic
953861322 3:46546304-46546326 TAGGCTGTAGGGTGGCACTGTGG + Intronic
954538620 3:51379542-51379564 CAGGCTTCGGGGAGGCACTGGGG - Intronic
957377555 3:79378303-79378325 CATGCTGGAGGCTGGCACCGAGG - Intronic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
958770738 3:98422312-98422334 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
959013669 3:101108736-101108758 CAAGCTGCAAGGTGGCAGCGAGG + Intergenic
959348264 3:105227177-105227199 CAGACATCTGGCTGGCACCGTGG - Intergenic
961653181 3:128427579-128427601 CAGTCTTCTGGATGGCACTGTGG - Intergenic
962764623 3:138549904-138549926 CAGGCTCCAGGCTGGTACTGGGG - Intronic
963623042 3:147635712-147635734 CAGGCTTCAGGCTGGCACTGAGG - Intergenic
968125599 3:196157702-196157724 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
968265215 3:197357439-197357461 CAGGCTCCCGGGCGGCACAGGGG + Intergenic
968512158 4:1000542-1000564 CATGCTCCAGGCTGGAACCGTGG - Intronic
968944406 4:3655778-3655800 GAGACTCCAGGGTGGCCCCGCGG + Intergenic
969516042 4:7648753-7648775 CAGGCACCAGGGCGGCCCCGGGG + Intronic
972279295 4:37587017-37587039 CAGGGATCAAGGTGTCACCGGGG + Intronic
973069091 4:45835287-45835309 CAGGCTCCAGGCTGGTACTGAGG + Intergenic
974112119 4:57537562-57537584 CAAACTGCAAGGTGGCACCGAGG - Intergenic
975790463 4:77944183-77944205 CAGGCTCCAGGCTGGTACTGGGG + Intronic
975836758 4:78430615-78430637 CAGGGTTCAAGGTGGGGCCGGGG - Intronic
976222952 4:82772743-82772765 CAGGGTTCAGGGGAGCACAGCGG - Intronic
976465090 4:85358042-85358064 CAGGCTTCAGGCTGGTACTGTGG + Intergenic
976883651 4:89960771-89960793 CAGGCTTGAGGGTGGGGCCCTGG + Intergenic
976963045 4:91003047-91003069 CAGGCTCCAGGCTGGTACCGGGG + Intronic
977157745 4:93594652-93594674 CAAGCTGCAAGGTGGCAGCGAGG - Intronic
978858284 4:113418253-113418275 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
978924983 4:114231996-114232018 CAGGCTCCAGGCTGGTACTGAGG - Intergenic
980519241 4:133909728-133909750 CAGGCTTCAGGCTGGTACTAAGG + Intergenic
981400915 4:144313203-144313225 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
982630622 4:157824792-157824814 CAGGCTCCAGGCTGGTACTGAGG - Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
985552288 5:539851-539873 CAGGCATCAGGGCTGCACCGGGG + Intergenic
985647704 5:1092910-1092932 CAGGCCTCAGGGTGGCTCTCAGG + Intronic
985761135 5:1749503-1749525 CTGGCTTCTCGGTGGCACAGCGG - Intergenic
986392553 5:7299944-7299966 CAGGCTTCAGGCTGCCAGCATGG + Intergenic
988725112 5:33919246-33919268 CAAGCTCCAGGGTGGTACTGAGG + Intergenic
989694448 5:44183443-44183465 CAGGCTCCAGGCTGACACTGGGG + Intergenic
990852281 5:60220136-60220158 CAGGCTTGTGGGTGGCAGTGGGG + Intronic
991923940 5:71684767-71684789 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
992354556 5:75967594-75967616 CAAGCTGCAAGGTGGCAGCGAGG + Intergenic
994646098 5:102470762-102470784 CAGGCTTCAGGCTGGTACTGGGG + Intronic
996025351 5:118639133-118639155 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
997912463 5:137889498-137889520 GAGGCGTCACGGTGGCACCGAGG + Exonic
999272889 5:150307885-150307907 CAGGCCTTGGGGTGGGACCGGGG - Intronic
1000511553 5:162189824-162189846 CAGGCTCCGGGGTGGTACTGGGG + Intergenic
1002548049 5:179965220-179965242 CCGGCTGCAGGGGGGCACTGTGG - Intronic
1002689642 5:181041548-181041570 GATGCTTCAGGGTGGCTCAGAGG + Intronic
1003409704 6:5851486-5851508 CGGGCTTCAGGGGAGCACCTGGG + Intergenic
1005259395 6:24042140-24042162 CAGGCCTCAGGTTGGTACTGAGG + Intergenic
1006391394 6:33761136-33761158 AGGGCTTCAGGGTGGCTCCAGGG - Intergenic
1006843521 6:37047410-37047432 CAGGCTGCAGGTTTGCACCCTGG + Intergenic
1008256197 6:49303187-49303209 CTGGCTCCAGGGTGGTACTGGGG - Intergenic
1008528549 6:52433476-52433498 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1009975562 6:70667743-70667765 GAGGCTTCCGGGTGGCGCGGAGG - Intergenic
1011093450 6:83633183-83633205 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1011375458 6:86681767-86681789 CAGGCTCCAGGATGGTACTGGGG + Intergenic
1012156015 6:95820327-95820349 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1012208300 6:96489048-96489070 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1014255836 6:119159491-119159513 CAGGCTTCAGGATGGCCAAGAGG + Intergenic
1015222208 6:130817103-130817125 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1015362297 6:132354453-132354475 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1015849722 6:137559763-137559785 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1016163212 6:140907544-140907566 CAGGCTTCCCAGTGCCACCGTGG - Intergenic
1019531243 7:1504474-1504496 CAGGCATCAGGCCGGCGCCGCGG - Intergenic
1019817802 7:3213934-3213956 CAGGCTCCTGGGAGGCAGCGTGG - Intergenic
1022911309 7:34901744-34901766 CAGGCTTTAGGATGGCAGTGGGG + Intergenic
1024327982 7:48127322-48127344 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1025260756 7:57416051-57416073 CAGGCCTCAGGGTGACCCCAAGG + Intergenic
1028197815 7:87927303-87927325 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1028261746 7:88674600-88674622 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1028583723 7:92432829-92432851 AAGGCCTCAGGGTGGCAGAGTGG + Intergenic
1031169387 7:118273274-118273296 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1031579197 7:123450784-123450806 CAAACTGCAAGGTGGCACCGAGG - Intergenic
1031612690 7:123845950-123845972 CAGGCTTCAGGCTGGCACTGAGG + Intronic
1032922568 7:136566599-136566621 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1033595887 7:142857348-142857370 CAGGCTTCATGGAGGCATCCAGG - Intronic
1034490134 7:151388726-151388748 CAGGCTTCAGGGAAGCAGGGAGG + Intronic
1035100862 7:156395352-156395374 CAGCATGCAGGGTGGCCCCGAGG - Intergenic
1035260456 7:157658637-157658659 CAGACGTCAGGGGGGCACCCAGG - Intronic
1035297819 7:157877005-157877027 CAGGCCTGAGTGTGGCACCAGGG + Intronic
1035566252 8:643324-643346 CAGGCTGCGGTGTGGCACAGGGG + Intronic
1035671113 8:1417671-1417693 GAGGCTCCAGGGGGGCACAGGGG + Intergenic
1038152974 8:24958864-24958886 AAGGCTTCAGGGAGGAGCCGCGG - Intergenic
1038600978 8:28942116-28942138 CAGTCTTCAGGGTGCCCCGGAGG + Intronic
1038613071 8:29071580-29071602 CGGGCTCCAGGGTGGTGCCGGGG - Intronic
1038901456 8:31848939-31848961 CATGCTCCAGGGTGGCAGTGGGG - Intronic
1039103667 8:33967435-33967457 CAAGCTGCAAGGTGGCAGCGAGG - Intergenic
1039281491 8:35990024-35990046 CAAGCTGCAAGGTGGCAGCGAGG - Intergenic
1039582873 8:38681269-38681291 CAGGCTCCAGAGTGGCAAGGAGG + Intergenic
1039835985 8:41256702-41256724 CAGGCTTGAGGGAGGCCCCAAGG - Intergenic
1042021897 8:64377887-64377909 CAGGCTTCAGGGGGACGCGGAGG - Intergenic
1042931881 8:74022289-74022311 CAGGCTCCCGGGTGGTAGCGGGG - Intronic
1043205865 8:77438368-77438390 CAGGCCCCAGGCTGGCACTGGGG + Intergenic
1043270767 8:78330106-78330128 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1043570541 8:81597961-81597983 CAAGCTTCAGGTCAGCACCGAGG + Intergenic
1045428341 8:102089064-102089086 CTGGCTTCAGGGTGGACCCCAGG - Intronic
1045814218 8:106261069-106261091 CAGGCTCCAGGCTGGTACTGGGG + Intergenic
1046074475 8:109299943-109299965 CAGGCTCCAGGCTGGTACTGGGG - Intronic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1049898028 9:128977-128999 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1051199105 9:14597572-14597594 CAGGCCTCTGCGTGGCACTGGGG - Intergenic
1051733192 9:20169522-20169544 CAGGCTTCAGGCTAACACTGGGG - Intergenic
1051885600 9:21889692-21889714 CAGGCTCCAGGCTGGTACCGAGG + Intronic
1053741106 9:41139275-41139297 CAGGCTCCAGGCTGGTACTGGGG + Intronic
1054687243 9:68292022-68292044 CAGGCTCCAGGCTGGTACTGGGG - Intronic
1056925406 9:90830240-90830262 CAGGCCTCAGGATGGCGCCGTGG + Intronic
1058015969 9:100032241-100032263 CTGGCTTCAGGGTGGAGCCCTGG - Intronic
1058342969 9:103920806-103920828 CAGGCTTCAGGCTGGCGCTAGGG - Intergenic
1059307709 9:113367757-113367779 AAGGCTTCTGGGGGGCACAGGGG + Intronic
1061429386 9:130521652-130521674 CAGGCTCCAGGGTGGTTCCTAGG + Intergenic
1061755935 9:132812673-132812695 CAGGCTTCCGGGTGGCAGGATGG - Intronic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062165525 9:135105559-135105581 CAGGCTCCAGGCTGGCCCCCGGG - Intronic
1062713669 9:137990793-137990815 CAGGCTTCAGGCTGGTACTGGGG - Intronic
1187588917 X:20693906-20693928 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1190548607 X:51556084-51556106 CAAGCTGCAAGGTGGCAGCGAGG - Intergenic
1191144813 X:57154973-57154995 CAGGCTCCAGGTTGGTACTGGGG + Intergenic
1191679195 X:63824751-63824773 CAGGCTTCAGGCTGGTACTAGGG + Intergenic
1192853442 X:74981630-74981652 CAGGCTTCAGGCTGGTGCTGGGG - Intergenic
1192869381 X:75171881-75171903 CAGGCTCCAGGTTGGTACTGGGG + Intergenic
1192871473 X:75188621-75188643 CAAACTTCAAGGTGGCAGCGAGG - Intergenic
1192968116 X:76201978-76202000 CAGGCTCCAGGCTGGTACTGAGG + Intergenic
1193404317 X:81083004-81083026 CAGGCTCCAGGCTGGTACTGGGG - Intergenic
1193820737 X:86161162-86161184 CTGGCTGCAGGGTGGCTCAGTGG + Intronic
1195075943 X:101327067-101327089 CAGGCTCCAGGTTGGTACTGGGG - Intergenic
1195135964 X:101907216-101907238 CAGGCTTCAGGTTGGCAGGTTGG + Intronic
1195985110 X:110621339-110621361 CAGGCTCCAGGATGGCACTGGGG + Intergenic
1196014202 X:110920022-110920044 CAGGCTTCAGGATGGCTGGGAGG + Intergenic
1197102538 X:122673349-122673371 CAGGCTCCAGGTTGGTACTGGGG - Intergenic
1197417333 X:126190822-126190844 CAAACTGCAGGGTGGCAGCGAGG - Intergenic
1197811999 X:130453225-130453247 CAAGCTGCAAGGTGGCAGCGAGG - Intergenic
1200831424 Y:7690911-7690933 CAGGCTTCAGGGGGGGAATGGGG + Intergenic