ID: 1078472446

View in Genome Browser
Species Human (GRCh38)
Location 11:11602347-11602369
Sequence CAGAGCATGGTTGAGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078472446_1078472456 28 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472456 11:11602398-11602420 CCTGGTGGCCTGGCCCTTCTGGG 0: 1
1: 0
2: 1
3: 54
4: 397
1078472446_1078472452 13 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472452 11:11602383-11602405 GGAGACATGAGAAATCCTGGTGG 0: 1
1: 0
2: 2
3: 19
4: 248
1078472446_1078472450 -8 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472450 11:11602362-11602384 ATGCTCTGCAACACAGAGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 208
1078472446_1078472449 -9 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472449 11:11602361-11602383 CATGCTCTGCAACACAGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 260
1078472446_1078472451 10 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472451 11:11602380-11602402 CTGGGAGACATGAGAAATCCTGG 0: 1
1: 0
2: 3
3: 25
4: 237
1078472446_1078472453 18 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472453 11:11602388-11602410 CATGAGAAATCCTGGTGGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 296
1078472446_1078472454 27 Left 1078472446 11:11602347-11602369 CCAGACCACTCAACCATGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1078472454 11:11602397-11602419 TCCTGGTGGCCTGGCCCTTCTGG 0: 1
1: 0
2: 4
3: 33
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078472446 Original CRISPR CAGAGCATGGTTGAGTGGTC TGG (reversed) Intronic
901449148 1:9325528-9325550 CAGAGCATGGTGGTGTGAGCAGG + Intronic
901757956 1:11452789-11452811 CAGAAAATGGTTGAGGGCTCGGG + Intergenic
903848018 1:26289992-26290014 CACAGGCTGGTTGAGTGTTCTGG - Intronic
904383354 1:30125893-30125915 CAGAGGAGGGTTGAGTGGCCTGG + Intergenic
905085239 1:35368176-35368198 CAGAGCAGAGTTGAGTAGTTGGG + Intronic
906529595 1:46515894-46515916 CAGAGCATGGTCCAGGGGCCCGG + Intergenic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
908464916 1:64384079-64384101 TAGAGAAAGTTTGAGTGGTCTGG + Intergenic
912136382 1:106664454-106664476 CATAGCCTGGTTGAATGGTTGGG + Intergenic
912330373 1:108814887-108814909 CAGAGTTTGGCTCAGTGGTCAGG - Intergenic
912412962 1:109490585-109490607 CAGGGCATGGAAGGGTGGTCTGG + Intronic
912867126 1:113267417-113267439 CAGAAATTGCTTGAGTGGTCTGG + Intergenic
913067547 1:115270366-115270388 CATAGCATGTTTGTGGGGTCCGG - Intergenic
913371659 1:118106408-118106430 AAGAGCATGGGTGACTGGCCTGG - Intronic
916831877 1:168501483-168501505 CAGAGAAAGTTCGAGTGGTCTGG - Intergenic
918130671 1:181625675-181625697 CAGAGAACGTCTGAGTGGTCTGG - Intronic
919903063 1:202058080-202058102 CTGAGCATGGTTGGGTGCTGTGG + Intergenic
920733758 1:208512702-208512724 CAGAGGATAATAGAGTGGTCTGG + Intergenic
923756689 1:236797351-236797373 CAGACCATGGTTGTGTGCCCTGG + Intronic
1064647914 10:17479013-17479035 CAGAGCGTGGAAAAGTGGTCAGG - Intergenic
1065392099 10:25193282-25193304 CAGAGAATGGCTGAGGGGTAGGG + Intronic
1068418596 10:56759876-56759898 CAGAGAATGGTTGAGCTGCCCGG - Intergenic
1071403688 10:85305872-85305894 CACCACATGGTTGTGTGGTCTGG + Intergenic
1072371447 10:94769503-94769525 CAGAGCAGGGTTTAGGGGTTGGG + Intronic
1072548803 10:96461355-96461377 CAGAGAAGGGTTGACTGATCTGG + Intronic
1074846142 10:117399779-117399801 TAGTCCATGGTTCAGTGGTCAGG - Intergenic
1075411731 10:122233462-122233484 CCCAGCACGGTTGAGTGGTGTGG + Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1077279561 11:1736345-1736367 CAGAGGATAGATGTGTGGTCAGG + Intronic
1077325298 11:1961172-1961194 CAGGGCCTGGCTGAGTGGGCAGG + Intronic
1078472446 11:11602347-11602369 CAGAGCATGGTTGAGTGGTCTGG - Intronic
1078474299 11:11618501-11618523 CAGAGGATGGCTGAGGGGTGAGG - Intronic
1078597914 11:12704378-12704400 AAGAACATGGTTGACTGGCCAGG - Intronic
1078894379 11:15584964-15584986 CAGAGCTTGGGTGAGAGGTCTGG + Intergenic
1079451664 11:20604086-20604108 CAGTGCAGGGTTGAGGGGTGAGG + Intronic
1082230037 11:49752550-49752572 CAGAGAAAGTTTTAGTGGTCTGG + Intergenic
1083010074 11:59388567-59388589 CAGAGCAAGATTGCCTGGTCTGG - Intergenic
1085037995 11:73311039-73311061 CAGAGCATAGTTCAGGGGCCTGG + Exonic
1089224378 11:116904187-116904209 CAGAACTTGGTTGAATGGCCAGG + Intronic
1089462693 11:118662229-118662251 CAGTGCCTGGCTCAGTGGTCGGG - Intronic
1202808279 11_KI270721v1_random:16351-16373 CAGGGCCTGGCTGAGTGGGCAGG + Intergenic
1091427072 12:400269-400291 TAGAGAAAGTTTGAGTGGTCTGG - Intronic
1091999423 12:5020203-5020225 CTGAGCATGGCTGTGTGGGCTGG - Intergenic
1092839280 12:12523711-12523733 CAGAACCTGATTGAGTGGTATGG - Intronic
1098936750 12:76489023-76489045 TACAGCAAGTTTGAGTGGTCTGG + Intronic
1098962739 12:76755916-76755938 AAGCTCATGGTTGAGAGGTCAGG + Intergenic
1104513493 12:129402756-129402778 AAGAGGATGGGTGAGGGGTCTGG + Intronic
1109999455 13:70175994-70176016 CATAGCCTGGATGAGTGCTCTGG - Intergenic
1110531392 13:76602754-76602776 CATAGCATGGTTGTGTGGGATGG - Intergenic
1112046621 13:95604030-95604052 CAGAGCTGGGATGAGTGCTCTGG - Intronic
1117201719 14:53396594-53396616 CAGAGAAAGTTTGAGTGGCCTGG + Intergenic
1117926756 14:60788869-60788891 CAGAGAAAGTTTCAGTGGTCTGG - Intronic
1118959937 14:70519941-70519963 TACAGAATGTTTGAGTGGTCTGG + Intergenic
1119017202 14:71071216-71071238 TGGAGAATGTTTGAGTGGTCTGG - Intronic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1119888463 14:78164279-78164301 CAGAGGATGGTTGATAGGGCTGG + Intergenic
1122184811 14:99983583-99983605 CAGAGAATGGTTGAGAGTGCTGG - Intronic
1122782895 14:104151045-104151067 CAGAGCCTGGTGGGGTGGTGAGG + Intronic
1122920233 14:104876895-104876917 AAGAGCAGGGTTGGGGGGTCAGG + Intronic
1122994819 14:105257407-105257429 CAGGGCGTGGATGAGTGGGCTGG - Intronic
1125579374 15:40774758-40774780 AAGAGCTTGGTTGAGTGGGTTGG - Intronic
1126914029 15:53445220-53445242 CAGAGCATGGTTATGTCTTCAGG - Intergenic
1128667149 15:69547001-69547023 CAGAGGATGCTTCACTGGTCTGG + Intergenic
1131079426 15:89522490-89522512 CAGAGTATGGGTGAGTAGGCAGG + Intergenic
1131492863 15:92878029-92878051 CAAATTTTGGTTGAGTGGTCAGG - Intergenic
1135270747 16:21067594-21067616 CTGATCATGGTTGACTGGGCAGG + Intronic
1136274612 16:29171161-29171183 CAGGGCCTGGGTGAGTGCTCAGG + Intergenic
1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG + Intergenic
1137502044 16:49019225-49019247 TAGAGCATGGCTGGCTGGTCAGG - Intergenic
1139082053 16:63534261-63534283 CGGAGAAAGTTTGAGTGGTCCGG - Intergenic
1140230887 16:73116247-73116269 CAGAGCCGGGTTGAGTGGGTGGG + Intergenic
1141909897 16:87051649-87051671 CAGAGCATGAGTGGGTGGACCGG + Intergenic
1142905242 17:3036961-3036983 CTGAGCATGGCTGACTGGCCTGG - Exonic
1143865561 17:9920321-9920343 CAGAGAAAGGGTGAGTGGGCAGG + Intronic
1144968922 17:19094841-19094863 CAGAGCATGGTTGAGCAGGGAGG - Intronic
1144978994 17:19157225-19157247 CAGAGCATGGTTGAGCAGGGAGG + Intronic
1144989228 17:19221007-19221029 CAGAGCATGGTTGAGCAGGGAGG - Intronic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1146412643 17:32600737-32600759 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
1152614172 17:81330286-81330308 CAGAGCCTGGTGGGGTGGCCGGG + Exonic
1152979019 18:255420-255442 CAGAGAAAGTCTGAGTGGTCTGG + Intronic
1152991850 18:370798-370820 CAGAGTAGGGTTGAGAGGCCTGG - Intronic
1154220068 18:12444713-12444735 TGGAGAATGTTTGAGTGGTCTGG - Intergenic
1156496309 18:37527568-37527590 CAGAGCATGGTTTGATGTTCCGG - Intronic
1161127323 19:2565678-2565700 AAGAACCTGATTGAGTGGTCTGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166230288 19:41422521-41422543 GAGAGCAAGGCTGAGTGCTCAGG - Intronic
1166938901 19:46351144-46351166 CAGGCCATGGTTGAGAGCTCAGG + Intronic
1167786654 19:51643359-51643381 CAGAGCAGGGCTGAGAGGCCTGG - Exonic
925508309 2:4595379-4595401 CAGAGCATGTTTGAGAGGTGGGG + Intergenic
928378239 2:30796417-30796439 GAGATCATGGATGAATGGTCTGG + Intronic
929455718 2:42063587-42063609 CAGAGCATGGTTGATATTTCTGG - Intergenic
929866823 2:45724688-45724710 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
929915905 2:46135355-46135377 CAGAGCATGGAAGTGGGGTCAGG + Intronic
930376007 2:50567410-50567432 CAGAACTTGGGTGAGGGGTCAGG + Intronic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
936079885 2:109425076-109425098 CGGAGAATGTTTGAGTGGCCTGG + Intronic
938681970 2:133701368-133701390 GAAAGTTTGGTTGAGTGGTCTGG + Intergenic
939559565 2:143716696-143716718 CAGAGTGTGGTTTAGTGGACTGG - Intronic
939973341 2:148687329-148687351 CAGAGAAAGTTTCAGTGGTCTGG - Intronic
940049346 2:149445757-149445779 CAGAGAAAGTTTGAGTGGTCTGG - Intronic
941077503 2:161022586-161022608 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
942196438 2:173525123-173525145 CAGAGTATGATTGACAGGTCTGG + Intergenic
945034815 2:205695830-205695852 CCCAGCATGGGTGAGTGGTGTGG + Intronic
946051967 2:216870639-216870661 GAGAGCTTGGTTGAGTGGTTGGG - Intergenic
946455363 2:219821134-219821156 CAAAGCAGGGTTGAGGGGGCAGG + Intergenic
948297270 2:236870817-236870839 CAGAGCCTAGTTGAGTGCTGGGG + Intergenic
1169361979 20:4957969-4957991 GAGATTATGGTTGAGTGGCCAGG - Intronic
1170443232 20:16399398-16399420 CAGAGCATGATTTAGTGAACAGG - Intronic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1172590205 20:36112471-36112493 CAGAGGAGGGGTGAGTGTTCTGG + Intronic
1173438332 20:43053218-43053240 CAGAGGATGGGTGAGTGATGGGG - Intronic
1173882651 20:46428719-46428741 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
1173942048 20:46919631-46919653 CAGAGAAAGTCTGAGTGGTCTGG - Intronic
1175611887 20:60358480-60358502 CAAAGCATGGGTGAGACGTCAGG - Intergenic
1181737531 22:24893461-24893483 CAGACCATGGCTGAGTGGCTGGG + Exonic
1182548540 22:31089262-31089284 CAGAGTGTGGGTGAGAGGTCAGG + Intronic
1182694402 22:32187026-32187048 CTGAGCATGGGTGAGTGGCTGGG + Intergenic
1184614966 22:45631782-45631804 GAGTGAATGGTTGAGGGGTCTGG - Intergenic
1185419625 22:50728245-50728267 CAGAGCATGCTGGAGATGTCAGG - Intergenic
949809826 3:7994699-7994721 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
950676685 3:14558400-14558422 CAGAGCACGGTTGGGAGCTCTGG + Intergenic
950988891 3:17409676-17409698 CAGAGAAAGTTTGAATGGTCTGG + Intronic
951530046 3:23690195-23690217 TGGAGAATGTTTGAGTGGTCTGG - Intergenic
953473573 3:43186871-43186893 CAGAGCATGGTGGAGAGGTTAGG - Intergenic
953646428 3:44760216-44760238 CAGAGAAAGTTTTAGTGGTCTGG - Intronic
955399545 3:58581604-58581626 CAGAGCATGTTTGAGAGGCGGGG - Intronic
955459754 3:59168908-59168930 TGGAGAATGTTTGAGTGGTCTGG + Intergenic
958889020 3:99762786-99762808 CAGAGCATGGTCGAGGAGTGTGG + Intronic
961486804 3:127222452-127222474 CAGAGCATCAGTGAGTGGGCAGG + Intergenic
961588625 3:127958079-127958101 TGGAGAATGGTTGAGTGTTCTGG + Intronic
961827947 3:129608329-129608351 CAGACCAGGGCTGAGGGGTCTGG - Intergenic
963902643 3:150746959-150746981 CAGAGTGTGGCTGACTGGTCAGG + Intronic
964185948 3:153942801-153942823 CAGAGAAAGTTTTAGTGGTCTGG - Intergenic
964324496 3:155531913-155531935 GAGAGAAAGTTTGAGTGGTCTGG - Intronic
966554250 3:181241376-181241398 GAGAACATAGTTTAGTGGTCAGG + Intergenic
967914640 3:194569524-194569546 CAGAGACTGGTGGATTGGTCAGG + Intergenic
969152723 4:5183968-5183990 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
969675603 4:8612733-8612755 CAGAGCATGTGTGCCTGGTCTGG - Intronic
971124271 4:23735656-23735678 CAAAGCATGGTTGGTTGGCCAGG + Intergenic
972391371 4:38616689-38616711 CAGGGTCTGGTTGAATGGTCTGG - Intergenic
972776247 4:42243726-42243748 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
975669551 4:76767173-76767195 GTGAGCATGGTTCAGTGGACTGG - Intronic
981493038 4:145361505-145361527 GAGAGAAAGTTTGAGTGGTCTGG + Intergenic
981683471 4:147426855-147426877 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
981928371 4:150164271-150164293 CAGAGTCTGATTAAGTGGTCTGG + Intronic
982946112 4:161625858-161625880 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
984637114 4:182123197-182123219 CAGAGAATGTTGTAGTGGTCTGG - Intergenic
986408430 5:7450331-7450353 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
986682165 5:10243778-10243800 TGGAGCAAGTTTGAGTGGTCTGG - Intronic
987088920 5:14493869-14493891 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
987124516 5:14799092-14799114 CGGAGAAAGTTTGAGTGGTCTGG + Intronic
987328979 5:16838357-16838379 TAGAGGAAGTTTGAGTGGTCTGG + Intronic
988655552 5:33207627-33207649 TGGAGAAAGGTTGAGTGGTCTGG + Intergenic
988669737 5:33368512-33368534 TGGAGAAAGGTTGAGTGGTCTGG - Intergenic
991705494 5:69354077-69354099 CTGGGCATGGTTGGGTGGTGAGG - Intronic
993599787 5:89907508-89907530 CAGAGAAAGATTTAGTGGTCTGG - Intergenic
996807418 5:127472305-127472327 GAGAGAAAGTTTGAGTGGTCTGG - Intergenic
997161011 5:131609313-131609335 CAGTGCATGGATGTCTGGTCAGG + Intronic
999524626 5:152391061-152391083 CAAAGAAAGTTTGAGTGGTCTGG - Intergenic
1002090757 5:176804449-176804471 CAGAGCATAGGTGAGTGTTGGGG + Intergenic
1005987378 6:30883567-30883589 CAGGACAAAGTTGAGTGGTCGGG - Intronic
1007095403 6:39209748-39209770 CAGAGCCTGGTTGGGTGTTAGGG - Intronic
1007379655 6:41479923-41479945 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
1008390779 6:50948933-50948955 TAGAGGAAGTTTGAGTGGTCTGG + Intergenic
1008902966 6:56644083-56644105 CAGAGAGTGGTTGAGAGTTCAGG - Intronic
1010999604 6:82572881-82572903 CAGTGCATGGTTAAGAGGCCAGG - Intergenic
1011019814 6:82800096-82800118 TGGAGAATGTTTGAGTGGTCTGG + Intergenic
1011095985 6:83663479-83663501 TGGAGAATGTTTGAGTGGTCTGG + Intronic
1011938540 6:92813302-92813324 CAGAGTAAGGATGACTGGTCAGG - Intergenic
1012109040 6:95202932-95202954 CAGAGAATGTTTTAGTGGTCTGG - Intergenic
1013796184 6:113891617-113891639 TAGAGAAAGGTTTAGTGGTCTGG + Intergenic
1014130420 6:117825235-117825257 CAGAGAAAGTTTTAGTGGTCTGG - Intergenic
1015515029 6:134074603-134074625 CAGAGAATGAGTGAGTGCTCAGG + Intergenic
1016867424 6:148781309-148781331 CCGAGAAAGTTTGAGTGGTCCGG + Intronic
1018709919 6:166491022-166491044 CAGAGCAGGGTCCTGTGGTCAGG + Intronic
1021934079 7:25613012-25613034 GGGAGAATGTTTGAGTGGTCTGG - Intergenic
1023170966 7:37390010-37390032 CAGAGCATGGGTGACTTCTCAGG - Intronic
1024932507 7:54678569-54678591 TGGAGAAAGGTTGAGTGGTCTGG - Intergenic
1025938457 7:66056241-66056263 TAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1027632012 7:80618621-80618643 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
1031067176 7:117117544-117117566 GAGGGCCTTGTTGAGTGGTCAGG + Intronic
1031252026 7:119396282-119396304 CAAAGCATGGTTGCCTTGTCTGG - Intergenic
1034568868 7:151938521-151938543 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1038454586 8:27664475-27664497 CAGAGCATTGGAGAGGGGTCAGG - Intronic
1039133072 8:34289937-34289959 CAGAGCATGGGTGAGTGCAGAGG + Intergenic
1039257809 8:35738142-35738164 CATAGCATGGTAGAGTGGAGAGG + Intronic
1039815197 8:41087576-41087598 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1040519914 8:48167756-48167778 GAGAGAATGGTCGAATGGTCAGG - Intergenic
1047306736 8:123658780-123658802 CAGACCATTCCTGAGTGGTCAGG - Intergenic
1047827949 8:128598182-128598204 CAGAGAATGTTTTAGTAGTCTGG + Intergenic
1048281531 8:133109119-133109141 CAGATAATGGTTGAAAGGTCAGG - Intronic
1050298686 9:4234098-4234120 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
1052543267 9:29838555-29838577 TGGAGAATGTTTGAGTGGTCTGG - Intergenic
1055179093 9:73360868-73360890 CAGAGCACAGCTGGGTGGTCAGG - Intergenic
1059357434 9:113710739-113710761 CAGAACAAGTTTGAGGGGTCTGG + Intergenic
1059842244 9:118230588-118230610 CAGTGCATGAATTAGTGGTCTGG - Intergenic
1061185899 9:129053129-129053151 CAGCCCATGGTTGTGTGGTGTGG + Intronic
1189745206 X:44161643-44161665 CAGAGCACGGTAGAGGGCTCTGG + Intronic
1190183578 X:48215704-48215726 TAGAGAAAGTTTGAGTGGTCTGG - Intronic
1190199552 X:48348770-48348792 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1190204344 X:48390680-48390702 TAGAGAAAGTTTGAGTGGTCAGG - Intronic
1190206192 X:48404723-48404745 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1190210182 X:48440330-48440352 TAGAGAAAGTTTGAGTGGTCAGG - Intergenic
1190660203 X:52647046-52647068 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1192144151 X:68669739-68669761 CAGAGCTTGGGGGAGGGGTCTGG - Intronic
1192847206 X:74918618-74918640 CAGAGCCTGGTAGAGTGGCAGGG - Intronic
1195294403 X:103461414-103461436 CAGAGTATTCTTGAGTGGTCAGG - Intergenic
1200714985 Y:6528531-6528553 CAGAGCATAGTTAATTGGTCTGG + Intergenic
1200913919 Y:8554913-8554935 TAGACCATGGTTCAGTGTTCAGG + Intergenic
1201018839 Y:9632600-9632622 CAGAGCATAGTTAATTGGTCTGG - Intergenic
1202594161 Y:26519826-26519848 CGGAGAATGTTTTAGTGGTCTGG + Intergenic