ID: 1078472513

View in Genome Browser
Species Human (GRCh38)
Location 11:11602889-11602911
Sequence CCCATTTTGACTCCTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078472513_1078472520 30 Left 1078472513 11:11602889-11602911 CCAGGTACAGGAGTCAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1078472520 11:11602942-11602964 ATTCATTTACATGGTTTCTAGGG 0: 1
1: 0
2: 20
3: 183
4: 885
1078472513_1078472519 29 Left 1078472513 11:11602889-11602911 CCAGGTACAGGAGTCAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1078472519 11:11602941-11602963 GATTCATTTACATGGTTTCTAGG 0: 1
1: 0
2: 3
3: 13
4: 235
1078472513_1078472518 21 Left 1078472513 11:11602889-11602911 CCAGGTACAGGAGTCAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1078472518 11:11602933-11602955 GAATTTATGATTCATTTACATGG 0: 1
1: 0
2: 0
3: 36
4: 320
1078472513_1078472517 -10 Left 1078472513 11:11602889-11602911 CCAGGTACAGGAGTCAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1078472517 11:11602902-11602924 TCAAAATGGGTGGTAAACTTGGG 0: 1
1: 0
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078472513 Original CRISPR CCCATTTTGACTCCTGTACC TGG (reversed) Intronic
903215798 1:21842751-21842773 CCCATCCTGGCCCCTGTACCTGG + Exonic
906217420 1:44051472-44051494 ACCATTTTGACTCCTGTGGATGG + Intergenic
907567562 1:55450081-55450103 CCCATTTAAACTCCTGCTCCAGG - Intergenic
907990016 1:59571351-59571373 ACCATTTTCTCTCCAGTACCTGG - Intronic
908022169 1:59909209-59909231 CCTATTTTTACTCCTGTAGCAGG + Intronic
915310771 1:155004862-155004884 CCCTTTTTGACCCCTGTGCCAGG - Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
916671788 1:167028709-167028731 CTCATTTTGACCCCTGTAGATGG + Intergenic
922791039 1:228311242-228311264 CCCATTTACACACCTGTGCCAGG - Intronic
922894209 1:229088120-229088142 CCCACATTGACTCCTGACCCCGG - Intergenic
922937596 1:229433774-229433796 CCCCTTTGGGCTCCTTTACCTGG - Intronic
1072637739 10:97188255-97188277 CCCAGCTTGGCTCCTGTCCCTGG + Intronic
1073893300 10:108124542-108124564 ACCATTTTGACTCCTGTGGATGG - Intergenic
1075760882 10:124855619-124855641 CCCAGGTTGACTCATGTTCCTGG + Intergenic
1078472513 11:11602889-11602911 CCCATTTTGACTCCTGTACCTGG - Intronic
1085571147 11:77558996-77559018 CCCATCTAGATTCCTTTACCCGG - Intronic
1089026390 11:115274883-115274905 CCCATCTTGACTCCTGCCCTGGG + Intronic
1089108048 11:116031621-116031643 CCCAGTTAGACTCCTGACCCAGG - Intergenic
1090031032 11:123206600-123206622 CCTATTTTTACTCCTTCACCAGG + Intergenic
1094258980 12:28469919-28469941 TCCATTTTGACTTCTGTATACGG - Intronic
1096575508 12:52550198-52550220 CCCACTTGGTCTCCAGTACCTGG + Exonic
1096593532 12:52678711-52678733 CCCATTTTGTTTGCAGTACCTGG + Exonic
1098307840 12:69119149-69119171 CCCTTTTTTATTCCTGTACATGG + Intergenic
1099020700 12:77400748-77400770 GCCCTTTGCACTCCTGTACCAGG - Intergenic
1101951561 12:109180078-109180100 CCCATTTTCTCACCTGTAGCTGG - Exonic
1102572043 12:113832688-113832710 CCCATTTTCATTCCTTCACCTGG - Intronic
1102727073 12:115075056-115075078 GCCATGTAGACTCCTGAACCTGG - Intergenic
1103608596 12:122106980-122107002 CCCAGTTGGAGTCCTGCACCCGG - Intronic
1107437272 13:40391041-40391063 CCCAACTTCACACCTGTACCAGG + Intergenic
1110244402 13:73305699-73305721 CACATGTTCACTCCTTTACCAGG + Intergenic
1110974240 13:81808858-81808880 AACATTTTGACTCCAGTCCCTGG + Intergenic
1114652092 14:24291687-24291709 CCCATTTCAACTTCTGTTCCAGG + Intronic
1116382737 14:44291682-44291704 CCCATTTGGCCTTCTGCACCGGG + Intergenic
1116752541 14:48904551-48904573 TCCATTTTGACTGCTATAACAGG - Intergenic
1117585118 14:57193668-57193690 CCCATGTTCAATCCTCTACCTGG + Intergenic
1117875212 14:60245149-60245171 CCCATGCTGACCCCTCTACCTGG + Intergenic
1118171418 14:63393089-63393111 CCCTTTTTGCCTCCTGTTCTAGG - Intronic
1119537445 14:75413973-75413995 CCAGGTGTGACTCCTGTACCCGG + Intergenic
1120893520 14:89509706-89509728 CCCATTATGTGTCCTGTACTGGG - Intronic
1121487829 14:94332045-94332067 CAGATTCTGACTCCTGTACTTGG - Intergenic
1122160816 14:99782481-99782503 CCCATTGTGTCTCCTGTTCCTGG + Intronic
1124619523 15:31265833-31265855 CCCATGCAGACTCCTGCACCCGG - Intergenic
1127153602 15:56105131-56105153 CCCATGTTGATTCCTCTACCTGG + Intronic
1128545011 15:68560968-68560990 CCCATTTTGGATCCTATCCCTGG - Intergenic
1129416639 15:75386739-75386761 CCTATTTTGAGTTCTGTACTTGG + Intronic
1129643410 15:77406902-77406924 CCTATTTTTACACCAGTACCAGG - Intronic
1131700547 15:94930868-94930890 CCCCTTTTCGCTCCAGTACCTGG - Intergenic
1132023376 15:98383935-98383957 CCCAATTTGCCACCTGTAGCAGG + Intergenic
1137250942 16:46740436-46740458 CCTATTTTGAACCCTGTATCGGG - Intronic
1139481081 16:67231085-67231107 CCCATTTGGGCTGCTGTGCCAGG - Intronic
1142656822 17:1399963-1399985 GCCATTTTGTCTCCTGTTCCCGG + Intronic
1145303270 17:21655061-21655083 CCCACTTTGACACCAGTCCCTGG - Intergenic
1145346768 17:22046781-22046803 CCCACTTTGACGCCAGTCCCTGG + Intergenic
1149075844 17:52595713-52595735 GCCATGATGACTCCTGTTCCAGG - Intergenic
1149644768 17:58232289-58232311 CCCATTTTGACTTCAGTACCTGG - Intronic
1154215102 18:12410001-12410023 CCCATTTTCACCCCTGCCCCAGG + Intronic
1155969888 18:32072492-32072514 GCAATTCTGACTCCTGTGCCTGG + Exonic
1157181063 18:45498580-45498602 CCCATCTCCACTCCTGTTCCTGG + Intronic
1163224632 19:15949435-15949457 CCCATCTTGTGGCCTGTACCTGG + Exonic
1168468893 19:56625247-56625269 CCCATTCTGACTCCAGAAGCTGG + Exonic
932121646 2:69106388-69106410 CCCATTTTGTTTCCTATACTTGG - Intronic
938422164 2:131154505-131154527 CCCATTGTGACTCCTGGCCACGG + Intronic
940012045 2:149064918-149064940 CCCACTCAAACTCCTGTACCAGG - Intronic
947302207 2:228700639-228700661 GTCTTTTTGTCTCCTGTACCTGG + Intergenic
1168986794 20:2056041-2056063 CCCAGTTTGTCTCCTGTATTAGG - Intergenic
1169382504 20:5120147-5120169 GCCTCTTTGACTCCTGAACCCGG + Intronic
1169604700 20:7303826-7303848 AGTATTTTGCCTCCTGTACCAGG - Intergenic
1171115787 20:22523838-22523860 TCCATGTTTACTCTTGTACCTGG + Intergenic
1171556134 20:26083739-26083761 CCCACTTTGACACCAGTCCCTGG + Intergenic
1174133843 20:48365163-48365185 CCCATTCAGACGCCTTTACCTGG + Intergenic
1175247935 20:57592618-57592640 CCCACTGTGATTCCTGGACCAGG - Intergenic
1176305146 21:5119298-5119320 CCCATTGTGCCTCCTGTAGAAGG - Intronic
1176654649 21:9577857-9577879 CCCACTTTGACACCAGTCCCTGG - Intergenic
1179234971 21:39537745-39537767 CCCTTTTTGACTGCTTTTCCTGG - Intergenic
1181895822 22:26106608-26106630 CCCAATTTGCCTCCTGCCCCAGG + Intergenic
949157808 3:849300-849322 GCCATTATGACTCCCGTTCCAGG - Intergenic
954549857 3:51472234-51472256 CCCAATTTCACTCCTGTTTCAGG + Intronic
955939450 3:64133820-64133842 CCCATGTTGACCCCCGTAACTGG - Intronic
956536022 3:70277829-70277851 GCCCTTTCGTCTCCTGTACCTGG - Intergenic
957581746 3:82082551-82082573 TCCAATTAGACTTCTGTACCAGG - Intergenic
957901970 3:86506190-86506212 CACATGTTGAATCCAGTACCAGG + Intergenic
966640580 3:182185190-182185212 GCCATTTATACTCCTTTACCAGG - Intergenic
969135788 4:5027700-5027722 CCCATCATCACTCCTGTAACAGG - Intergenic
979015561 4:115428327-115428349 CCTATTTTGACATCTGCACCAGG - Intergenic
984994496 4:185415983-185416005 CCCCTTTTCACTACTGTACTTGG - Intronic
985277034 4:188247120-188247142 GCCATTGTGACTTCGGTACCTGG + Intergenic
988338217 5:29934346-29934368 CCCATTTTGCCTCCTGGTCATGG - Intergenic
988440384 5:31226643-31226665 CCCTTTTTGCCTCCTCTCCCAGG + Intronic
993619741 5:90153722-90153744 CCCATTTTTCCTCCTGGACCAGG - Intergenic
995345998 5:111118351-111118373 CCCATTCTGAGTCTTCTACCTGG + Intronic
996012557 5:118497327-118497349 TCCATTCTGACCCCTGCACCTGG - Intergenic
1000673626 5:164093032-164093054 CACATTCTGACCCCTGTACTAGG - Intergenic
1002440519 5:179262144-179262166 CCAATTCTGACTCCTGCACGTGG + Intronic
1002836453 6:869110-869132 CCCATTGTGAGTTCTGTGCCAGG - Intergenic
1003086618 6:3065473-3065495 CCCACTTTGGATCCTGTGCCTGG - Intronic
1003383947 6:5650228-5650250 CCCACTTTGACATCGGTACCAGG - Intronic
1008527535 6:52420974-52420996 CCTCTTCTGAATCCTGTACCCGG + Intronic
1011552734 6:88544815-88544837 ACCATATTGACTCCTGTCGCTGG + Intergenic
1016889400 6:148990961-148990983 CCCTTGTTCACTCCTGTTCCAGG - Intronic
1017920042 6:158863682-158863704 CCCATCTTGACTCCTATGCCTGG + Intergenic
1022257431 7:28673288-28673310 CCCATTTTAAAACCTGTCCCAGG + Intronic
1024728395 7:52227431-52227453 CCCATTTTGCATCCAGTATCAGG + Intergenic
1025281272 7:57627715-57627737 CCCACTTTGACACCAGTCCCTGG - Intergenic
1025303457 7:57837792-57837814 CCCACTTTGACACCAGTCCCTGG + Intergenic
1026231747 7:68489927-68489949 CCCATTTTGATTCCATCACCAGG - Intergenic
1027853137 7:83474246-83474268 CCCATTATTACTCATGTATCAGG - Intronic
1029361977 7:100094402-100094424 CCCATGTTGTTTTCTGTACCAGG + Intronic
1034148503 7:148893859-148893881 CCCATCTTTATTCCTGTAGCTGG - Intergenic
1036723208 8:11197498-11197520 CCCAATGTGACTCCTGCTCCTGG + Intronic
1037982554 8:23264789-23264811 CCCCTTTCCACTCCTGCACCAGG + Intergenic
1039278084 8:35954458-35954480 GCCATGATGACTCCTGTTCCAGG - Intergenic
1040757128 8:50790195-50790217 CACATTTTGCCTCCTGTCACTGG + Intronic
1048044097 8:130756953-130756975 CCTACTTTGCCTCCTTTACCTGG - Intergenic
1050920026 9:11188731-11188753 ACCATTTTGGCTCCTGTACATGG - Intergenic
1053394215 9:37758029-37758051 TCCATTTTGACTCCTGTGTTTGG - Intronic
1058966420 9:110043132-110043154 TCCATTTTGCCTCCTATGCCTGG + Intronic
1061838552 9:133344649-133344671 CCCATTTTGCCTCCTGCCCCGGG + Intronic
1203632369 Un_KI270750v1:81315-81337 CCCACTTTGACACCAGTCCCTGG - Intergenic
1196458485 X:115906292-115906314 CTCTTTTTGACACCTGTCCCTGG + Intergenic
1197041486 X:121941105-121941127 GCCATTTTTACCCCTGTAGCTGG + Intergenic
1197083031 X:122441202-122441224 CCCATGTAGACTCATGTTCCAGG - Intergenic
1199789569 X:151139850-151139872 GCCATTTTGTATCCTGTACTGGG + Intergenic
1202124450 Y:21556187-21556209 GCCTTTTTGACTCTTGTTCCAGG - Intergenic
1202154558 Y:21873193-21873215 GCCTTTTTGACTCTTGTTCCAGG + Intergenic