ID: 1078473656

View in Genome Browser
Species Human (GRCh38)
Location 11:11611918-11611940
Sequence ATTTGTGTCTACAAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078473656_1078473664 17 Left 1078473656 11:11611918-11611940 CCAGGTTCCTTGTAGACACAAAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1078473664 11:11611958-11611980 CTGGCCTCCCATTTGACCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 251
1078473656_1078473658 -2 Left 1078473656 11:11611918-11611940 CCAGGTTCCTTGTAGACACAAAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1078473658 11:11611939-11611961 ATGTAAACCAAGCCCCTGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078473656 Original CRISPR ATTTGTGTCTACAAGGAACC TGG (reversed) Intronic
900281991 1:1875851-1875873 ATTCATGTCTACCTGGAACCTGG + Intronic
906594764 1:47065740-47065762 ATTTATCTCTTCAAAGAACCAGG - Intergenic
908980715 1:69954016-69954038 ATGTGTTTCTACCAGGTACCTGG + Intronic
909101449 1:71354320-71354342 GTCTGTATCTACAAAGAACCAGG + Intergenic
909780441 1:79539849-79539871 ATTTGAGAATACATGGAACCAGG - Intergenic
910188728 1:84573881-84573903 ATTTATGTTTCCAAGGAACGAGG - Intronic
911904293 1:103547528-103547550 ATTTGTTTCTAAAAGGCTCCTGG + Intronic
915878583 1:159641488-159641510 AGTTATGTCCAGAAGGAACCAGG - Intergenic
915962459 1:160278677-160278699 ATTTGTGTCTGCCAGGAAGACGG + Exonic
918594522 1:186277568-186277590 ATTAGTGGCTACCAGGAGCCAGG + Intergenic
918850573 1:189683321-189683343 ATTTGTACGTACAAGGAATCAGG + Intergenic
919134242 1:193488635-193488657 ATTTGTGTATACAATGTACATGG + Intergenic
921368064 1:214393573-214393595 ATTAGCTTCTACAAGGAACAAGG + Intronic
922204958 1:223437977-223437999 GTTTGTGTTTAAAAGGATCCTGG - Intergenic
922678818 1:227572734-227572756 CTCTGTGGCCACAAGGAACCAGG - Intronic
923907896 1:238406112-238406134 ATTTGTGTCAAAAAAGAACAGGG - Intergenic
1064956350 10:20915218-20915240 ATTTATATATGCAAGGAACCAGG + Intronic
1065734857 10:28742396-28742418 ATTTGTGACAACATTGAACCTGG + Intergenic
1066024719 10:31343835-31343857 ATTTGAGTTTACAAAGAACACGG - Intronic
1066295454 10:34050328-34050350 ACTTCTGAATACAAGGAACCAGG + Intergenic
1068242364 10:54319490-54319512 ATTGGTGGCTACAAGGAGCTGGG + Intronic
1068603487 10:58979982-58980004 ATTTGTGGCTACAGGAAAGCAGG - Intergenic
1069235918 10:66072971-66072993 ATTTGTGACAACAGGGAATCTGG + Intronic
1071558209 10:86623126-86623148 ATAGCTGTCTACAAGGAAGCAGG + Intergenic
1072000377 10:91189399-91189421 ATGTGTGTCTACTATGTACCAGG - Intronic
1072546862 10:96446794-96446816 ATTTGTCTCTACCAGGAATGTGG + Intronic
1073961959 10:108942242-108942264 ATTTGTGTCTAAAAGCAAGGCGG - Intergenic
1074950584 10:118330675-118330697 GTTTGGGTGTACATGGAACCAGG - Intronic
1076034534 10:127188101-127188123 ATTTTTTTCTAGAATGAACCTGG + Intronic
1076199794 10:128548965-128548987 ATCTGTGTCCACAATGGACCTGG + Intergenic
1078473656 11:11611918-11611940 ATTTGTGTCTACAAGGAACCTGG - Intronic
1079438659 11:20485218-20485240 TTTTGTTTCTGCAAGGAACCTGG - Intronic
1083259800 11:61516736-61516758 ATTTGGATTTACAAGGAACGTGG + Intronic
1084900944 11:72309269-72309291 AGTTGAGCCTCCAAGGAACCTGG - Intronic
1086869495 11:92019258-92019280 CTTTGTGTCAAGAAGGGACCTGG - Intergenic
1087670348 11:101099034-101099056 ATTTGCCTCTCCAAGGACCCTGG - Intronic
1087676475 11:101168458-101168480 ACTTGTGTCTAAAATGAACCAGG - Intergenic
1088505324 11:110521889-110521911 ATGTGTACCTACAAGGAGCCAGG - Intergenic
1090719621 11:129459573-129459595 ATTTGTGTGTTTAAGGAGCCAGG - Intergenic
1095701797 12:45198235-45198257 ATTTGTCGCTAAAAGGAACTGGG - Intergenic
1095882673 12:47154896-47154918 AGTTGTTTCTAAATGGAACCAGG - Intronic
1097361665 12:58665401-58665423 ATTAGAGTCTACAATGTACCAGG + Intronic
1097472117 12:60007451-60007473 ATTTGAGAATACAAGGAACATGG - Intergenic
1098415630 12:70231460-70231482 TTTTGTTTCTATAAGGAACTAGG + Intergenic
1100523106 12:95395171-95395193 GTTTGTGTCTAAATGGAACGTGG - Intergenic
1100633531 12:96411994-96412016 TTTCATGTCTACAATGAACCAGG + Intergenic
1105939679 13:25136425-25136447 ATTTTTGGCTACAAGTAACTAGG + Intergenic
1107227837 13:38072247-38072269 ATTTTTCTCTACAAGGATTCTGG + Intergenic
1108376456 13:49818550-49818572 ATTTGTCACTAAAGGGAACCAGG - Intergenic
1108683735 13:52801498-52801520 ATTTGTGTTGGCAAGGAAGCAGG - Intergenic
1109448117 13:62471771-62471793 AGTTGTGTGTACAAGCAACATGG - Intergenic
1110145480 13:72185350-72185372 ATTTGTTTCAACAAGGAATAGGG - Intergenic
1110469584 13:75843852-75843874 ACTTGTATCTACAAGCAGCCGGG + Intronic
1111461386 13:88546927-88546949 ATTTGTCTCCTCAAGGAGCCAGG + Intergenic
1112727519 13:102321463-102321485 ATTTGTGTTTATAATGACCCTGG - Intronic
1115825590 14:37269031-37269053 AGATATGTATACAAGGAACCAGG - Intronic
1117262648 14:54052091-54052113 ATTTGTGTATATCAGGTACCTGG + Intergenic
1119854980 14:77892892-77892914 TTTTGTGTCTACTCTGAACCTGG + Intronic
1126114843 15:45199127-45199149 ATTTTTTTCTACGTGGAACCTGG - Intronic
1127663938 15:61126093-61126115 CTCTGGGGCTACAAGGAACCAGG + Intronic
1130836720 15:87657247-87657269 AATTGTGTAGACAAGGTACCAGG + Intergenic
1134381568 16:13732020-13732042 ATTTGTGTTTACTAGGAAGCAGG + Intergenic
1137458804 16:48639087-48639109 ATTTGTGGCTTCAACCAACCAGG + Intergenic
1141056080 16:80815691-80815713 ATTTCTCAGTACAAGGAACCAGG - Intergenic
1141328813 16:83089037-83089059 AATTTTGTCTATAAAGAACCAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144381997 17:14708695-14708717 ATTTGTCACTAGAAAGAACCAGG - Intergenic
1145853705 17:28131179-28131201 ATTTATGTGTAGAAGAAACCCGG - Intronic
1146565987 17:33913139-33913161 ATTTGGGCTTACAAGGAGCCGGG + Intronic
1147797106 17:43052083-43052105 ATCTGTGTCTTCAGGAAACCAGG - Intronic
1149439432 17:56662482-56662504 ATTTGTGTCTATTAGGAAAAGGG - Intergenic
1149820616 17:59773367-59773389 CTTAGTGTCTACAATGAGCCAGG + Intronic
1151168778 17:72227874-72227896 ATTTGTCTATAGAAAGAACCAGG - Intergenic
1154005319 18:10522647-10522669 GTTTGTGTAGACAAGGAACCTGG + Intergenic
1156375251 18:36509128-36509150 ATTTGTGTGTTGAAGAAACCGGG - Intronic
1157544183 18:48536395-48536417 AGGTTTGTCTTCAAGGAACCTGG - Intergenic
1158833667 18:61307424-61307446 AGTTGTGTCTACAAGGACATAGG - Intergenic
1159529297 18:69635507-69635529 ATTTGTGCTTCCATGGAACCAGG + Intronic
1161438067 19:4275732-4275754 ATTTGTGTTTACCAGGAGCTGGG + Intergenic
1165983965 19:39751412-39751434 TTCTGTGTCTCCAAGTAACCTGG + Intergenic
931945415 2:67300838-67300860 ATTTATGTCAAAAAGGAACATGG + Intergenic
932831389 2:74993805-74993827 ATTTGTATCAACAAGGGTCCTGG + Intergenic
936899061 2:117463357-117463379 ATTTGTGTTTTCAAAGAACCAGG + Intergenic
946158006 2:217819716-217819738 ATTTGGGTCTAGAAGGAGTCAGG - Intronic
946378806 2:219330889-219330911 AGTGGTGTCAGCAAGGAACCTGG + Intronic
1173001950 20:39111216-39111238 ATTTGTGTCTTCAATCTACCTGG - Intergenic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1175508854 20:59507733-59507755 ATTTTTCTCTAAAAGGAACCAGG - Intergenic
1175616754 20:60406392-60406414 ATTTGCATCTTCAAGGACCCAGG + Intergenic
1176317698 21:5263535-5263557 ATTTTTGTATACAAATAACCTGG + Intergenic
1176475563 21:7200310-7200332 ATTTTTGTATACAAATAACCTGG + Intergenic
1177244674 21:18507763-18507785 ATTTGGGGATACAATGAACCAGG - Intergenic
1177853599 21:26377317-26377339 TTTTGTGTCTACATGCAACATGG - Intergenic
1184629838 22:45768195-45768217 ATTTTTCTCTATAAGGAACCAGG + Intronic
950822629 3:15777369-15777391 ATTTGGTTCTACACGGAATCAGG + Intronic
950973633 3:17216169-17216191 ATTTGTGACTTCAAGGAAGATGG + Intronic
951624075 3:24641051-24641073 ATTTGTGTTTAAAAGAAATCTGG + Intergenic
952077087 3:29710196-29710218 ATTTGTGAATAGAAAGAACCAGG + Intronic
952196313 3:31078965-31078987 ATTTGTGGAGACAAGGACCCTGG + Intergenic
953042186 3:39265405-39265427 CCTTGTGTCTACAGAGAACCTGG - Exonic
956316640 3:67945241-67945263 ATTTGTGTCTGGAAGGGAGCAGG - Intergenic
956507684 3:69960204-69960226 ATCTGTGTTTACAGGGAACTTGG + Intronic
958268777 3:91472051-91472073 ATTTGTGTCTAGAAGTTAACAGG + Intergenic
960727804 3:120688326-120688348 CTTTGTGTCAAAAAGAAACCAGG + Exonic
961954566 3:130788222-130788244 AATTGTTTCAACAAGCAACCAGG + Intergenic
965984920 3:174739358-174739380 ATTTATGTCTACAAGAAAATCGG + Intronic
967502588 3:190217173-190217195 ATTTTTTTCCACATGGAACCAGG + Intergenic
970287632 4:14535858-14535880 TTTTGTGACTACATGGAAACAGG - Intergenic
970739336 4:19215630-19215652 ATGTGTGTTTATAAGGCACCAGG + Intergenic
971411392 4:26376298-26376320 ATTGGTGGCTACCAGGGACCTGG - Intronic
972966749 4:44519817-44519839 ATTTTTGTTGAAAAGGAACCAGG + Intergenic
973291815 4:48478427-48478449 ATTTGTATCTAAAAGCAACATGG - Intergenic
975070142 4:70124875-70124897 ATTTGTGACATCAATGAACCTGG + Intergenic
975345011 4:73283329-73283351 ATCTGTGTCTACAACCACCCTGG - Intergenic
977648805 4:99445393-99445415 ATTTGTTTCTACAGGGGCCCAGG - Intergenic
981107667 4:140899578-140899600 ATGTGTGTGCACAGGGAACCTGG + Intronic
981327523 4:143467692-143467714 ATTTGCTTCTGCTAGGAACCAGG + Intronic
989359497 5:40584570-40584592 ATATGTGTCTACAGGGGAGCAGG - Intergenic
991523744 5:67531848-67531870 ATTTTTGTCTACAAGCTAGCTGG - Intergenic
992643672 5:78792579-78792601 ATTTTTGCATACAAGGAAACAGG - Intronic
993208148 5:84911780-84911802 ATTTGTGTCTTCAAAAAAACTGG - Intergenic
993826003 5:92687728-92687750 ATTTGTTTTTACAAAGAGCCTGG - Intergenic
994079431 5:95690368-95690390 ATTTGTTAGTACAATGAACCAGG + Intronic
1000136396 5:158356588-158356610 CTTTGTTTCTAGAAGAAACCAGG - Intergenic
1002589001 5:180275270-180275292 ATTTATTTCTACTAGGTACCTGG + Intronic
1003766317 6:9241222-9241244 ATGTCTGTGTACATGGAACCAGG + Intergenic
1005335084 6:24788037-24788059 ATTTGTATCTATAAAGAACTAGG + Intergenic
1006790806 6:36699773-36699795 AATTGTATCTGCATGGAACCTGG + Intronic
1009174415 6:60442242-60442264 ATTTGTGTCTAGAAGTTAACAGG - Intergenic
1010143395 6:72637921-72637943 ATTTTTCTCTAGAAGAAACCCGG + Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1021905930 7:25333077-25333099 ATTTATGTCTATTAGGAAGCGGG - Intergenic
1021921399 7:25489024-25489046 TTTTGTTTCTAACAGGAACCTGG - Intergenic
1025797837 7:64756488-64756510 ATTTGAGGCTACTAAGAACCTGG + Intergenic
1028970974 7:96858635-96858657 CTCTGTGACTACAAGGATCCTGG + Intergenic
1031907912 7:127481077-127481099 ATTTGTTTCTGCCAGGAACCCGG - Intergenic
1032964941 7:137085555-137085577 ATTTGTGACTACCATGAAGCAGG + Intergenic
1036507990 8:9373254-9373276 ATTTCTGTATACAAGGTACAGGG - Intergenic
1040683297 8:49839723-49839745 ATTTGGGTCTACAAGGAATATGG - Intergenic
1043627513 8:82280637-82280659 ATTTGCTTCTGCAAGGCACCTGG - Intergenic
1044094600 8:88047620-88047642 ACCTGTGTCTACAAGGAGGCTGG + Intronic
1045075083 8:98556261-98556283 ATTTGTTTCTATCAGGCACCTGG - Intronic
1045707132 8:104937330-104937352 ATTTGGGGCTACCAGGAACCAGG + Intronic
1048954496 8:139524630-139524652 ATTTGTTGCTACAAGGACCCAGG + Intergenic
1049149870 8:141027648-141027670 ATTAGTGCCTACAATGATCCAGG + Intergenic
1050043963 9:1524424-1524446 ATTAGTATCTACAATCAACCAGG - Intergenic
1051044431 9:12856442-12856464 ATTTGGGGATACAAGGAACTAGG + Intergenic
1051498205 9:17748650-17748672 CTTTGTGTCTTCCATGAACCAGG + Intronic
1052212184 9:25918324-25918346 ATTTGTGTTTAAAAATAACCTGG + Intergenic
1053446553 9:38157578-38157600 ATTTGTGTCTAGAAAGAAAGAGG - Intergenic
1056261113 9:84849559-84849581 TTTAGTATCTACAATGAACCAGG + Intronic
1056799121 9:89679154-89679176 ATTTCTGTCTTCCAGGACCCTGG - Intergenic
1059584584 9:115592179-115592201 CTTTGTGTCTATAAAGACCCAGG - Intergenic
1059993503 9:119887503-119887525 ATATGAATCTACAAGGAACAGGG - Intergenic
1203410997 Un_KI270579v1:2999-3021 ATTTTTGTATACAAATAACCTGG + Intergenic
1188948766 X:36342130-36342152 ATATGTGTTTACCAGGAAGCTGG - Intronic
1194958063 X:100204213-100204235 ATATGTGTGTACAAGGTACTGGG - Intergenic
1195056312 X:101148891-101148913 ATATATGTATACAATGAACCAGG + Intronic
1197072248 X:122313644-122313666 AGCTGTGACTAAAAGGAACCAGG + Intergenic
1201297915 Y:12480632-12480654 TTTGGTGTCTACAGGGAAGCAGG + Intergenic
1201486936 Y:14505028-14505050 ATTCATGTCTACATAGAACCTGG + Intergenic