ID: 1078474159

View in Genome Browser
Species Human (GRCh38)
Location 11:11616681-11616703
Sequence CAGTGGTACTAGAGACAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078474159_1078474165 28 Left 1078474159 11:11616681-11616703 CCTATTTGTCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1078474165 11:11616732-11616754 TACACTTACCAGTGGTCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1078474159_1078474164 20 Left 1078474159 11:11616681-11616703 CCTATTTGTCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1078474164 11:11616724-11616746 TTGAGTTTTACACTTACCAGTGG 0: 1
1: 0
2: 3
3: 15
4: 179
1078474159_1078474166 29 Left 1078474159 11:11616681-11616703 CCTATTTGTCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1078474166 11:11616733-11616755 ACACTTACCAGTGGTCCACTGGG 0: 1
1: 0
2: 1
3: 2
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078474159 Original CRISPR CAGTGGTACTAGAGACAAAT AGG (reversed) Intronic
905471863 1:38198336-38198358 CAGAGGTTCACGAGACAAATTGG + Intergenic
905882514 1:41474046-41474068 CAGTGGAACTAGGACCAAATAGG + Intergenic
911733522 1:101313297-101313319 GAATGGTGCTAGGGACAAATTGG - Intergenic
912605076 1:110981707-110981729 CACTTGGGCTAGAGACAAATAGG + Intergenic
913411790 1:118560346-118560368 CAGTGCTACTTGAGACACAGTGG + Intergenic
914204386 1:145514686-145514708 CAGGGGTGCTAGAGAAAGATGGG - Intergenic
914483508 1:148087874-148087896 CAGGGGTGCTAGAGAAAGATGGG - Intergenic
916391599 1:164336909-164336931 CAGTGGTTTATGAGACAAATGGG - Intergenic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
917482324 1:175423006-175423028 AAGTGGCACGAGAGACAGATAGG - Intronic
918028486 1:180778585-180778607 TAGTGTTACTAGAGTCTAATGGG - Intronic
920345825 1:205305104-205305126 CAGTGGCACTAAAGTCAAACGGG - Intronic
920518781 1:206607035-206607057 CGTTTGTAATAGAGACAAATTGG + Intronic
921588417 1:216975679-216975701 GAGAGGTACTAGAGAAAAATAGG + Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
1067783410 10:49225649-49225671 CAGTGGTGCTGGAGACAGAGTGG - Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068455847 10:57252744-57252766 CTCTGGAACAAGAGACAAATGGG - Intergenic
1070394395 10:75999550-75999572 CAGAGGAACTAGAGGCACATTGG - Intronic
1077358304 11:2128622-2128644 CAGTGGTACTAATGACATCTGGG + Intergenic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1086127763 11:83366990-83367012 CAGTTGTTATAGAGAAAAATTGG - Intergenic
1087525653 11:99308152-99308174 CAGTAGTACTAGAAAGAAACAGG - Intronic
1088502577 11:110497385-110497407 CAGTGGAAGTAGAGCCAATTAGG + Intergenic
1089392806 11:118113552-118113574 CTGACGTATTAGAGACAAATGGG - Intronic
1090993622 11:131843478-131843500 CAGTGGTAATAGTCATAAATTGG - Intronic
1091050484 11:132364246-132364268 CAGTGATACAGGAGACAAAAAGG + Intergenic
1092928777 12:13295798-13295820 GAGTGGTATGAGAGACACATTGG - Intergenic
1094291016 12:28850263-28850285 CAATGGTACTAGCGACAAAATGG - Intergenic
1097479540 12:60104490-60104512 CAGTGGTAGTACAGTCAATTTGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098894775 12:76045566-76045588 GAGTGGTACTTAAGAAAAATGGG - Exonic
1099364744 12:81754320-81754342 TAGGGGAAATAGAGACAAATAGG - Intronic
1100158149 12:91826060-91826082 CAGTGGAACTAGAGAACAAAAGG - Intergenic
1101527678 12:105546449-105546471 GAGTGGAACTAGAAAAAAATGGG + Intergenic
1102124705 12:110470355-110470377 CAGTAGCACCAGAGACAAAAAGG - Intronic
1103657808 12:122487482-122487504 CAGTATTACTGGAGTCAAATAGG - Intronic
1105008686 12:132739652-132739674 AAGTGTTATGAGAGACAAATAGG - Intronic
1107242676 13:38255769-38255791 AAGTGGGACTAGAGATAATTGGG - Intergenic
1111506241 13:89193249-89193271 GAGTGTTACTAGAGATAAAGGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112131297 13:96526541-96526563 CAATGGTACTAGGGAAAAAAAGG - Intronic
1117493822 14:56280796-56280818 AAGTCGAACTAGAGACAATTAGG + Intronic
1117873943 14:60230994-60231016 GATTGTTACTAGAGACAAAGAGG - Intergenic
1118204857 14:63713389-63713411 CAATGGCAGTAGAGAGAAATGGG - Intronic
1118249107 14:64141623-64141645 CAGTGGTGCCAGAGAAAAATAGG - Intronic
1119805918 14:77482376-77482398 CAATGGAACTACAGACAACTGGG - Exonic
1120621187 14:86766707-86766729 CAGGAGTACAAGAGAAAAATTGG + Intergenic
1121859500 14:97303300-97303322 CAGTGGTTCTAGAGTCACCTGGG - Intergenic
1126065948 15:44826557-44826579 CAATGTTTCTAGAGACATATTGG - Intergenic
1126093887 15:45074009-45074031 CAATGTTTCTAGAGACATATTGG + Exonic
1127294291 15:57596188-57596210 CAGTGCCCCCAGAGACAAATGGG - Intronic
1129724629 15:77895297-77895319 CCGTGGTGCTGCAGACAAATTGG - Intergenic
1130272652 15:82460081-82460103 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1130465004 15:84187434-84187456 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1130487684 15:84407370-84407392 CAGTGGTGCTGCAGATAAATTGG + Intergenic
1130499261 15:84486103-84486125 CAGTGGTGCTGCAGATAAATTGG + Intergenic
1130587294 15:85192048-85192070 CAGTGGTGCTGCAGATAAATTGG - Intergenic
1134591676 16:15459513-15459535 AAATGTTACTAGAGACAAAGAGG + Intronic
1135856750 16:26018698-26018720 CAGTGATCCTGGAGGCAAATTGG + Intronic
1138771796 16:59674235-59674257 CAGTGGCATTAGAGTCTAATAGG + Intergenic
1139001885 16:62520769-62520791 CAATGGTATTAGAGTCTAATCGG - Intergenic
1139557397 16:67721094-67721116 AGGTGGTACTGGAGACAAATTGG - Intergenic
1142876635 17:2855020-2855042 CAGTGGAACCAGAGACACCTGGG + Intronic
1143316849 17:6039358-6039380 CAGTGTCTCAAGAGACAAATAGG - Intronic
1151945154 17:77315696-77315718 CAGTGCTATTGGAGACAAAGTGG + Intronic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1155457922 18:26040842-26040864 CAGTCTTAGTAGAGACAAACTGG + Intronic
1164300593 19:23958689-23958711 CAGACTTCCTAGAGACAAATTGG + Intergenic
1166271711 19:41718522-41718544 GAGTGTTTGTAGAGACAAATTGG - Intronic
1168606558 19:57764831-57764853 CTGTGGCATTAGAGAAAAATTGG - Intergenic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
928467843 2:31539594-31539616 CAGTGTTAGTAGAGACAACATGG + Intronic
928895611 2:36259155-36259177 TAGAGGTAATAGAGACAAAGAGG - Intergenic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929602489 2:43213065-43213087 CAGAGGAGCTAGAGACAAAGGGG + Intergenic
934018129 2:87912166-87912188 TATTGGTACTGGAGACAGATTGG - Intergenic
934521596 2:95023547-95023569 CACTGGTAATAGAGAGACATTGG - Intergenic
937548441 2:123055004-123055026 CACTGTTACAAGAGAGAAATAGG - Intergenic
940392966 2:153154042-153154064 CAGAGGGAACAGAGACAAATGGG - Intergenic
942481552 2:176393525-176393547 CAAGGGAACTAGAGACAAACTGG + Intergenic
943260435 2:185653248-185653270 GAGTGTTACTAGAGATAAAGAGG + Intergenic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
945654815 2:212610525-212610547 CAGTAGTACTTGAGAGAGATGGG + Intergenic
946012748 2:216579496-216579518 CAGTGGCACTAGTGACATTTTGG - Intergenic
1169640285 20:7743642-7743664 CAGTGGTGCTAGAGACCAACAGG - Intergenic
1169976960 20:11340111-11340133 AAATGGTTCTAGAGACAATTTGG + Intergenic
1179894459 21:44353608-44353630 CTGGGGTTCTAGAGACACATGGG - Exonic
1182438770 22:30348839-30348861 CAGTGGTACAGGAGACAACCAGG - Intronic
1184816044 22:46871108-46871130 GAGTTGTATTAGAGACAAAGAGG + Intronic
951835076 3:26974030-26974052 CAGTGGAACTAGAGACTCCTAGG + Intergenic
955244519 3:57211930-57211952 CATTGTTACTAGAGACACACAGG + Intronic
955699462 3:61669745-61669767 CAGTTGTACTTGAGACAGTTTGG + Intronic
957835490 3:85583149-85583171 CTGTGGTACTAAAGACATGTAGG - Intronic
958662874 3:97093882-97093904 CAGAGGTCCTAGATACAAAAAGG - Intronic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
960987268 3:123289333-123289355 CAGTATTACTCGAAACAAATGGG + Intronic
964796695 3:160506110-160506132 CAGTAATAATAGAGACAAAGGGG - Intronic
970031695 4:11683439-11683461 CTGTGGTACAACAGACAAACTGG + Intergenic
971628295 4:28953433-28953455 CTGTGGAACTGTAGACAAATAGG + Intergenic
975433664 4:74324487-74324509 CAGTGCTACTAGAGAACAATAGG + Intergenic
976242506 4:82973434-82973456 CAGTGGAACTAAGGATAAATAGG - Intronic
982797810 4:159666308-159666330 CAGTGTCAGTAGAGACACATGGG - Intergenic
988418727 5:30978991-30979013 CAGTGGCACTAATGACATATGGG + Intergenic
992170960 5:74101646-74101668 CAGTGGCACTATTGACAATTTGG - Intergenic
993289921 5:86053881-86053903 CAGTGATACTGGAGAACAATAGG - Intergenic
996657645 5:125960522-125960544 CAGTGATGCTAGAAACAACTTGG + Intergenic
999516947 5:152311032-152311054 CAATGGTAGCAGAGACAAAGAGG - Intergenic
1000756787 5:165171161-165171183 CAGTATTAATAGAGACACATTGG - Intergenic
1004026537 6:11824700-11824722 CAGAGGAATAAGAGACAAATTGG - Intergenic
1005771245 6:29074632-29074654 CAAAGTTACTAGGGACAAATAGG + Intronic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006898961 6:37487816-37487838 CAGTGGAACTGCAGATAAATTGG - Intronic
1007641103 6:43340416-43340438 CTGTGGTCCTAGAGACAGAACGG - Exonic
1008839475 6:55883448-55883470 CAGTAGCAATAGAGAAAAATAGG + Intergenic
1011698917 6:89937311-89937333 CAGTGGTACAAGACACGATTTGG + Intronic
1013414453 6:109912536-109912558 CAAAGGTAGTAGAGACAAAATGG - Intergenic
1016212742 6:141560026-141560048 CAATGGTACAAGTGACAAAAAGG - Intergenic
1019862530 7:3673331-3673353 CAGTGTCAATAGAGACAAAAGGG + Intronic
1020624854 7:10565438-10565460 AAGTGGTACTAGAGATAAACAGG + Intergenic
1020839609 7:13199237-13199259 AAGTGGCACCAGAGAAAAATGGG + Intergenic
1021952377 7:25787784-25787806 CAGTGGTCCTGGACACACATAGG + Intergenic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1027786709 7:82589347-82589369 AAGTGTTACTAGAGAAAATTAGG - Intergenic
1032369775 7:131336201-131336223 AAGTGTTACTAGAGATAAAAAGG - Intronic
1035088402 7:156281786-156281808 AAGTGTTACTAGAGATAAACAGG - Intergenic
1035897073 8:3414897-3414919 GAGTGGTGCTAGAGACACGTAGG - Intronic
1036531746 8:9596202-9596224 AAATGGTATTTGAGACAAATGGG + Intronic
1036666778 8:10750125-10750147 CACTGTTACATGAGACAAATAGG - Intronic
1044253868 8:90037093-90037115 CAGCGCTGCTATAGACAAATAGG - Intronic
1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1050634944 9:7602435-7602457 GAGTGGAACTAGAGATGAATTGG + Intergenic
1052531717 9:29693314-29693336 CACTGGTACTCTAGACAAAATGG + Intergenic
1054859906 9:69939888-69939910 AAGTGTTACTAGAGATAAAGAGG + Intergenic
1058917614 9:109582823-109582845 CAGTGGTAATATTGACAAATGGG + Intergenic
1059243941 9:112833717-112833739 GAGTGGGACTAGAGTCAAATGGG - Intronic
1185843417 X:3414750-3414772 GAATGATACTACAGACAAATTGG + Intergenic
1186221321 X:7352317-7352339 AACTGGTTCTAGACACAAATAGG - Exonic
1187985169 X:24802569-24802591 TAGTGATGCTAGAGACAAGTAGG + Intronic
1188542894 X:31269462-31269484 CAGTGGTACTGGGAACAAGTAGG - Intronic
1193103873 X:77646350-77646372 AACTGTTACAAGAGACAAATAGG + Intronic
1193421022 X:81282064-81282086 CAGTGGTAAAAGAGACAAAGAGG + Intronic
1195091647 X:101465420-101465442 AAGTGGTAGTAAAGACAAAAAGG + Intronic
1196137846 X:112229450-112229472 CTCTGGTACTAGAGAAAAGTAGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198024789 X:132694461-132694483 CAGTGTGATTAGAGAAAAATGGG + Intronic
1199126399 X:144126840-144126862 TATTGGTACTGGAGACAGATTGG + Intergenic
1200168470 X:154053773-154053795 CAGTGGCATTAAATACAAATTGG - Intronic
1201231590 Y:11870075-11870097 GAATGATACTACAGACAAATTGG - Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic