ID: 1078475053

View in Genome Browser
Species Human (GRCh38)
Location 11:11622490-11622512
Sequence AAGGAAGGAGTGGATGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078475053_1078475065 23 Left 1078475053 11:11622490-11622512 CCAGCGGCATCCACTCCTTCCTT No data
Right 1078475065 11:11622536-11622558 GCCCTCTGCCCTTCAGCCACCGG No data
1078475053_1078475057 -10 Left 1078475053 11:11622490-11622512 CCAGCGGCATCCACTCCTTCCTT No data
Right 1078475057 11:11622503-11622525 CTCCTTCCTTGGCCTCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078475053 Original CRISPR AAGGAAGGAGTGGATGCCGC TGG (reversed) Intergenic
No off target data available for this crispr