ID: 1078475417

View in Genome Browser
Species Human (GRCh38)
Location 11:11625020-11625042
Sequence ATCAGATAATAGGTGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078475413_1078475417 7 Left 1078475413 11:11624990-11625012 CCTCCTGCTGGGGATCATTGTGA No data
Right 1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG No data
1078475415_1078475417 4 Left 1078475415 11:11624993-11625015 CCTGCTGGGGATCATTGTGAGGA No data
Right 1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG No data
1078475408_1078475417 29 Left 1078475408 11:11624968-11624990 CCTTTACTTTAAATAAATCCTGC No data
Right 1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG No data
1078475412_1078475417 11 Left 1078475412 11:11624986-11625008 CCTGCCTCCTGCTGGGGATCATT No data
Right 1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078475417 Original CRISPR ATCAGATAATAGGTGTAAGC AGG Intergenic
No off target data available for this crispr