ID: 1078475847

View in Genome Browser
Species Human (GRCh38)
Location 11:11629237-11629259
Sequence CTCTAGGAATGGGAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078475847_1078475851 -4 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475851 11:11629256-11629278 AGAGCCTCAAATAAATAGCAAGG No data
1078475847_1078475855 17 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475855 11:11629277-11629299 GGACCCTGTGTGAGGGACTGCGG No data
1078475847_1078475859 29 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475859 11:11629289-11629311 AGGGACTGCGGGTGCCTGCCAGG No data
1078475847_1078475854 10 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475854 11:11629270-11629292 ATAGCAAGGACCCTGTGTGAGGG No data
1078475847_1078475853 9 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475853 11:11629269-11629291 AATAGCAAGGACCCTGTGTGAGG No data
1078475847_1078475856 18 Left 1078475847 11:11629237-11629259 CCTTACATCTCCCATTCCTAGAG No data
Right 1078475856 11:11629278-11629300 GACCCTGTGTGAGGGACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078475847 Original CRISPR CTCTAGGAATGGGAGATGTA AGG (reversed) Intergenic
No off target data available for this crispr