ID: 1078479010

View in Genome Browser
Species Human (GRCh38)
Location 11:11659983-11660005
Sequence GAGGCCCATCCCTATTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078479010_1078479022 30 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479022 11:11660036-11660058 GACTGGGGTTTCTCAAAGAAGGG No data
1078479010_1078479017 13 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479017 11:11660019-11660041 AAGGCCTAAACAGCAAAGACTGG No data
1078479010_1078479021 29 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479010_1078479014 -6 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479014 11:11660000-11660022 GGCCTCATCCAATCAGGTGAAGG 0: 16
1: 220
2: 583
3: 866
4: 1173
1078479010_1078479018 14 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479018 11:11660020-11660042 AGGCCTAAACAGCAAAGACTGGG No data
1078479010_1078479019 15 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479019 11:11660021-11660043 GGCCTAAACAGCAAAGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078479010 Original CRISPR GAGGCCCATCCCTATTAGGG AGG (reversed) Intergenic
No off target data available for this crispr