ID: 1078479014

View in Genome Browser
Species Human (GRCh38)
Location 11:11660000-11660022
Sequence GGCCTCATCCAATCAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2858
Summary {0: 16, 1: 220, 2: 583, 3: 866, 4: 1173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078479011_1078479014 -9 Left 1078479011 11:11659986-11660008 CCCTAATAGGGATGGGCCTCATC No data
Right 1078479014 11:11660000-11660022 GGCCTCATCCAATCAGGTGAAGG 0: 16
1: 220
2: 583
3: 866
4: 1173
1078479009_1078479014 -5 Left 1078479009 11:11659982-11660004 CCCTCCCTAATAGGGATGGGCCT No data
Right 1078479014 11:11660000-11660022 GGCCTCATCCAATCAGGTGAAGG 0: 16
1: 220
2: 583
3: 866
4: 1173
1078479010_1078479014 -6 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479014 11:11660000-11660022 GGCCTCATCCAATCAGGTGAAGG 0: 16
1: 220
2: 583
3: 866
4: 1173
1078479012_1078479014 -10 Left 1078479012 11:11659987-11660009 CCTAATAGGGATGGGCCTCATCC No data
Right 1078479014 11:11660000-11660022 GGCCTCATCCAATCAGGTGAAGG 0: 16
1: 220
2: 583
3: 866
4: 1173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078479014 Original CRISPR GGCCTCATCCAATCAGGTGA AGG Intergenic
Too many off-targets to display for this crispr